Chaetodon auriga | University of the Philippines Mindanao DNA Barcoding NEC Project (DOST-MECO-TECO) | Marine Biodiversity Database Project
Chaetodon auriga (Forsskål, 1775)
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Osteichthyes
  • Order » Acanthuriformes
  • Family » Chaetodontidae
  • Genus » Chaetodon
  • Species » auriga
  • Chaetodon auriga (Forsskål, 1775)
    (Threadfin butterflyfish)
  • Description »  

    Marine; reef-associated; non-migratory; depth range 0 - 60 m . Tropical; 30°N - 20°S

    Maturity: Lm 13.0  range ? - ? cm Max length : 25.0 cm TL male/unsexed;

    Dorsal spines (total): 12 - 13; Dorsal soft rays (total): 22 - 25; Anal spines: 3; Anal soft rays: 19 - 21. Body shape (shape guide): short and / or deep;  Cross section: compressed.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [Divilacan, Isabela] [Governor Generoso Davao Oriental]
  • Collectors/Field Observers »   Sheena Batacan, Glycinea M. de Peralta
  • Species ID by »   Maybelle A. Fortaleza
  • Institution/Project »   University of the Philippines Mindanao DNA Barcoding NEC Project (DOST-MECO-TECO)
  • Collection Code »   [] [MIN_1908_GOVG_041A]
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:08 October 2009 (FishBase)
  • Sample Availability and Preservation »   Tissue preserved in 95% ETOH; whole fish specimen fixed in formalin
  • GenBank Accession Number »   OR524309
  • Curated by »   Maybelle Fortaleza
  • Last Updated »   Sept. 15, 2024, 5:27 p.m.
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GGCACCCTCTATCTAGTATTTGGTGCTTGAGCTGGGATAGTAGGTACTGCCCTAAGTCTGCTCATTCGGGCAGAGCTCAGCCAACCAGGCTCCCTCCTGGGCGACGACCAGATCTATAACGTAATTGTTACAGCGCATGCATTCGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGAGGGTTCGGAAACTGACTGATTCCTCTAATGATTGGAGCCCCAGATATAGCCTTCCCTCGGATAAATAACATGAGCTTTTGGCTCCTGCCCCCCTCCTTTTTCCTACTCCTTGCCTCTTCTGGCGTAGAGTCCGGGGCTGGTACTGGATGAACGGTTTATCCCCCACTAGCTGGCAACCTAGCACACGCCGGAGCATCCGTTGATCTAACCATCTTCTCCCTTCACCTCGCAGGAGTTTCCTCCATCCTTGGGGCAATTAACTTCATCACAACAATTCTTAACATGAAACCCCCTGCCATATCTCAGTACCAGACCCCTCTTTTCGTGTGATCTGTTTTAATTACAGCCGTCCTGCTTCTCCTATCCCTGCCCGTTCTTGCAGCCGGGATTACAATACTCCTTACAGATCGAAACCTCAATACAACCTTTTTCGACCCCGCAGGAGGAGGCGACCCTATCCTGTACCAACACCTGTCCTGA

    • Visit FishBase Website
    Visit BOLD Systems Website
    University of the Philippines Mindanao, Mintal, Tugbok District, Davao City © ABRAHAM Program 2025 - All Rights Reserved. 681 visit(s) today - 801435 total visits (1014 average daily visits): 2023-05-22 - 2025-07-20 (790 days)