Naso hexacanthus | University of the Philippines Mindanao DNA Barcoding NEC Project (DOST-MECO-TECO) | Marine Biodiversity Database Project
Naso hexacanthus (Bleeker, 1855)
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Osteichthyes
  • Order » Acanthuriformes
  • Family » Acanthuridae
  • Genus » Naso
  • Species » hexacanthus
  • Naso hexacanthus (Bleeker, 1855)
    (Sleek unicornfish)
  • Description »  

    Marine; brackish; reef-associated; depth range 0 - 150 m , usually 10 - 137 m . Tropical; 25°C - 28°C ; 31°N - 32°S, 30°E - 122°W

    Maturity: Lm 45.0  range ? - ? cm Max length : 75.0 cm FL male/unsexed; ; common length : 50.0 cm TL male/unsexed; ; max. reported age: 44 years

    Dorsal spines (total): 6; Dorsal soft rays (total): 26 - 29; Anal spines: 2; Anal soft rays: 27 - 30. This species is distinguished by the following characters: body moderately deep and compressed, its depth 2.6 to 3.2 times in standard length (SL); dorsal profile of body uniformly convex, without any bony horn-like projection or protuberance anteriorly on head; mouth small; incisiform teeth very small, somewhat pointed, finely serrate on edges, as many as 80 in upper jaw and 100 in lower jaw of large adults; continuous unnotched D VI (rarely V or VII),26-29; A II,27-30; pectoral-fin rays 17-18 (usually 17); pelvic fins I,3; caudal fin slightly emarginate in young, becoming truncate in adults; caudal peduncle slender, subcylindrical, with a pair of bony plates on each side that develop large sharp antrorse keels with age; body colour dark brownish grey, shading ventrally to yellowish (life colour may vary from dark brown to light blue-grey); edge of operculum and preopercle usually dark brown; dorsal and anal fins yellowish with faint diagonal brown bands and a blue margin; tongue black at lengths of 25 cm or more . Body shape (shape guide): fusiform / normal;  Cross section: compressed.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [Santa Ana, Cagayan Valley] [Governor Generoso, Davao Oriental] [Sasa, Davao City, Davao del Sur]
  • Collectors/Field Observers »   JM Del Castillo, GM de Peralta
  • Species ID by »   Maybelle A. Fortaleza
  • Institution/Project »   University of the Philippines Mindanao DNA Barcoding NEC Project (DOST-MECO-TECO)
  • Collection Code »   [NEC_1903_STAA_014_A] [MIN_1908_GOVG_033A] [FDP_IGCS_2111_010A]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:06 May 2010 (FishBase)
  • Sample Availability and Preservation »   Tissue preserved in 95% ETOH; whole fish specimen fixed in formalin
  • GenBank Accession Number »   OR524507
  • Curated by »   Maybelle Fortaleza
  • Last Updated »   Nov. 28, 2024, 12:32 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GGCACCCTTTATTTAGTATTTGGTGCTTGAGCTGGGATAGTAGGCACAGCCTTAAGTCTACTCATTCGGGCAGAACTAAGCCAACCAGGCGCCCTCCTCGGAGATGACCAAATCTATAATGTAATTGTTACGGCGCATGCTTTTGTAATAATTTTCTTTATAGTAATGCCAATCATAATTGGAGGATTTGGAAACTGACTAATTCCACTAATGATCGGGGCCCCAGATATGGCATTCCCCCGAATAAATAACATGAGCTTTTGACTGCTCCCTCCCTCTTTCCTCCTCCTCCTTGCATCATCTGGTGTAGAAGCCGGGGCTGGAACCGGATGAACAGTTTATCCCCCTTTAGCTGGTAATCTAGCACATGCAGGAGCTTCCGTTGATCTGACTATTTTCTCCCTTCATCTGGCAGGAATCTCCTCAATTCTAGGGGCCATTAACTTCATCACAACCATCATCAATATGAAACCTCCTGCTATTTCTCAGTACCAAACTCCCCTGTTTGTCTGAGCTGTACTAATCACGGCAGTTCTGTTACTTCTATCTCTTCCAGTCCTTGCTGCTGGTATTACAATGCTCCTTACCGACCGAAACCTTAACACAACCTTCTTCGACCCCGCAGGAGGAGGGGACCCAATTCTTTACCAACACCTCTCCTGA