Siganus canaliculatus | University of the Philippines Mindanao FishDive Project | Marine Biodiversity Database Project
Siganus canaliculatus (Park, 1797)
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Osteichthyes
  • Order » Acanthuriformes
  • Family » Siganidae
  • Genus » Siganus
  • Species » canaliculatus
  • Siganus canaliculatus (Park, 1797)
    (White-spotted spinefoot)
  • Description »  

    Marine; brackish; reef-associated; oceanodromous ; depth range 1 - 50 m . Tropical; 30°N - 35°S, 49°E - 174°W

    Maturity: Lm 11.6, range 12 - ? cm Max length : 40.0 cm TL male/unsexed; ; common length : 20.0 cm TL male/unsexed;

    Dorsal spines (total): 13; Dorsal soft rays (total): 10; Anal spines: 7; Anal soft rays: 9; Vertebrae: 23. This species is distinguished by the following characters: body compressed, moderately slender, its depth 2.3-2.8 in SL; last anal-fin spine 1.2-1.5 times in longest anal-fin spine (usually the third); soft parts of dorsal and anal fins low, longest dorsal-fin ray 0.7-1 times in longest dorsal-fin spine; caudal fin almost emarginate in specimens under 10 cm standard length, forked in larger fish; 16-26 (rarely 27) scale rows between lateral line and bases of leading dorsal-fin spines. Colour of body highly variable, greenish grey to yellow brown with numerous (100-200) pearly blue to whitish spots on nape and trunk, match-head size on lower sides; 2-3 rows between first spine of dorsal fin and lateral line (area of eye would cover about 6 spots in this region), and about 10 rows between highest point of lateral line and base of first anal-fin spine; when frightened or injured, sides mottled light and dark brown and cream, creating 6 or 7 regularly spaced, dark diagonal zones with paler zones of similar width between them; dark eye-sized spot usually just behind upper end of gill opening, and a narrow bar along upper edge of gill cover ( Ref. 9813, 90102).
    Body shape (shape guide): fusiform / normal;  Cross section: compressed.

    Adults inhabit inshore, algae reefs, estuaries and in large lagoons with algae-rubble habitats. Mainly common on rocky substrates . In contrast to S. fuscescens, this species seems to tolerate more turbid waters, occurring within the vicinity of river mouths especially around seagrass beds. Adults also occur several kilometers offshore in deep, clear waters. Juveniles form very large schools in shallow bays and coral reef flats; school size reduces with size, with adults occurring in groups of 20 individuals or so. Herbivorous, feed on benthic algae and to some extent on seagrass. Fished by trawling and seine netting; bycatch in traps set in deep water and marketed fresh in very large numbers . Consumed as food; and have poisonous spines .

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [General Santos City, South Cotabato] [Santa Maria, Davao Occidental] [General Santos City, South Cotabato]
  • Collectors/Field Observers »   CL Nañola, MA Fortaleza, JJ Lanutan, KL Labrador
  • Species ID by »   Maybelle A. Fortaleza
  • Institution/Project »   University of the Philippines Mindanao FishDive Project
  • Collection Code »   [None] [MIN_1910_STAM_021A] [FDP_SGES_2112_042A]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:10 March 2015 (FishBase)
  • Sample Availability and Preservation »   Tissue preserved in 95% ETOH; whole fish specimen fixed in formalin
  • GenBank Accession Number »   OR524668
  • Curated by »   Maybelle Fortaleza
  • Last Updated »   Sept. 15, 2024, 9:41 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GGCACCCTTTATCTAGTATTTGGTGCTTGAGCCGGAATGGTAGGTACAGCTTTAAGCCTACTAATTCGAGCAGAACTTAGCCAACCAGGCGCTCTTCTTGGAGATGACCAAATTTATAATGTCATTGTTACCGCCCATGCATTCGTAATAATTTTCTTTATAGTAATGCCAATCATGATTGGAGGGTTCGGAAACTGACTAATCCCCCTAATGATCGGAGCCCCTGACATGGCATTCCCACGAATGAACAACATGAGCTTCTGGCTCCTTCCCCCATCTTTCCTTCTTCTCCTAGCCTCTTCTGGGGTAGAAGCTGGGGCGGGAACTGGTTGAACAGTTTACCCCCCTCTAGCAGGAAATCTAGCACACGCCGGCGCATCCGTAGACCTAACTATTTTCTCCCTGCATTTAGCCGGTATTTCATCAATTCTAGGGGCTATTAACTTCATTACAACTATTATTAACATGAAACCTCCTGCTATCTCCCAGTATCAGACCCCACTCTTCGTATGGGCCGTCCTAATTACAGCTGTCCTTCTTCTTCTTTCCCTACCTGTTCTGGCTGCTGGAATTACAATGCTCCTAACAGACCGAAACTTAAATACCACATTCTTCGACCCAGCAGGAGGAGGGGACCCAATCCTCTACCAACACCTATGCTGA