Siganus canaliculatus | University of the Philippines Mindanao FishDive Project | Marine Biodiversity Database Project
Siganus canaliculatus (Park, 1797)
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Osteichthyes
  • Order » Acanthuriformes
  • Family » Siganidae
  • Genus » Siganus
  • Species » canaliculatus
  • Siganus canaliculatus (Park, 1797)
    (White-spotted spinefoot)
  • Description »   (Wikipedia) Siganus canaliculatus, the white-spotted spinefoot, white-spotted rabbitfish, pearly spinefoot, seagrass rabbitfish, slimy spinefoot or smudgespot spinefoot is a species of marine ray-finned fish, a rabbitfish belonging to the family Siganidae. It is native to the western Pacific Ocean and Indian Ocean where it occurs on reefs and in lagoons.
    Full article at Wikipedia
  • Local Name »  
  • Locality/Distribution »   [General Santos City] [Santa Maria, Davao Occidental] [General Santos City, South Cotabato]
  • Collectors/Field Observers »   CL Nañola, MA Fortaleza, JJ Lanutan, KL Labrador
  • Species ID by »   Maybelle A. Fortaleza
  • Institution/Project »   University of the Philippines Mindanao FishDive Project
  • Collection Code »   FDP_SGES_2112_042_A
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:10 March 2015 (FishBase)
  • Sample Availability and Preservation »   Tissue preserved in 95% ETOH; whole fish specimen fixed in formalin
  • GenBank Accession Number »   OR524668
  • Curated by »   Maybelle Fortaleza
  • Last Updated »   Sept. 15, 2024, 9:41 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GGCACCCTTTATCTAGTATTTGGTGCTTGAGCCGGAATGGTAGGTACAGCTTTAAGCCTACTAATTCGAGCAGAACTTAGCCAACCAGGCGCTCTTCTTGGAGATGACCAAATTTATAATGTCATTGTTACCGCCCATGCATTCGTAATAATTTTCTTTATAGTAATGCCAATCATGATTGGAGGGTTCGGAAACTGACTAATCCCCCTAATGATCGGAGCCCCTGACATGGCATTCCCACGAATGAACAACATGAGCTTCTGGCTCCTTCCCCCATCTTTCCTTCTTCTCCTAGCCTCTTCTGGGGTAGAAGCTGGGGCGGGAACTGGTTGAACAGTTTACCCCCCTCTAGCAGGAAATCTAGCACACGCCGGCGCATCCGTAGACCTAACTATTTTCTCCCTGCATTTAGCCGGTATTTCATCAATTCTAGGGGCTATTAACTTCATTACAACTATTATTAACATGAAACCTCCTGCTATCTCCCAGTATCAGACCCCACTCTTCGTATGGGCCGTCCTAATTACAGCTGTCCTTCTTCTTCTTTCCCTACCTGTTCTGGCTGCTGGAATTACAATGCTCCTAACAGACCGAAACTTAAATACCACATTCTTCGACCCAGCAGGAGGAGGGGACCCAATCCTCTACCAACACCTATGCTGA