Siganus spinus | University of the Philippines Mindanao FishDive Project | Marine Biodiversity Database Project
Siganus spinus (Linnaeus, 1758)
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Osteichthyes
  • Order » Acanthuriformes
  • Family » Siganidae
  • Genus » Siganus
  • Species » spinus
  • Siganus spinus (Linnaeus, 1758)
    (Little spinefoot)
  • Description »  

    Marine; reef-associated; depth range 1 - 50 m , usually 1 - 20 m . Tropical; 24°C - 28°C ; 30°N - 30°S, 77°E - 129°W

    Maturity: Lm ?  range ? - ? cm Max length : 28.0 cm TL male/unsexed; ; common length : 18.0 cm TL male/unsexed;

    Dorsal spines (total): 13; Dorsal soft rays (total): 10; Anal spines: 7; Anal soft rays: 9; Vertebrae: 13. The species can adopt a number of camouflage patterns involving off-white, pale gray to blackish, and various shades of brown. The basic pattern consists of a labyrinth of narrow bands with upper half vermiculate, the lower ones tend to meander horizontally. This pattern extends to the fins. Iris golden dissected by a chocolate cross. 4-5 irregular off-white bars on caudal peduncle. Scales fine on cheeks, densely packed over lower 2/3 of preopercular region. Midline of thorax without scales between pelvic ridges. Fin spines stout, pungent, venomous. Preopercular angle 87-100 degrees. Body shape (shape guide): fusiform / normal;  Cross section: compressed.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [General Santos City, South Cotabato] [General Santos City, South Cotabato]
  • Collectors/Field Observers »   CL Nañola, MA Fortaleza, JJ Lanutan, KL Labrador
  • Species ID by »   Maybelle A. Fortaleza
  • Institution/Project »   University of the Philippines Mindanao FishDive Project
  • Collection Code »   [None] [FDP_SGES_2112_040A]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:12 March 2015 (FishBase)
  • Sample Availability and Preservation »   Tissue preserved in 95% ETOH; whole fish specimen fixed in formalin
  • GenBank Accession Number »   OR524678
  • Curated by »   Maybelle Fortaleza
  • Last Updated »   Sept. 15, 2024, 9:44 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GATATTGGCACCCTTTATTTAGTATTTGGTGCTTGAGCCGGGATAGTAGGAACAGCCTTAAGCCTACTGATTCGAGCAGAACTTAGCCAACCAGGCGCTCTTCTTGGAGACGACCAAATTTATAATGTTATTGTTACCGCCCATGCATTCGTAATGATTTTCTTTATAGTAATGCCAATTATGATTGGAGGGTTTGGAAACTGACTAATCCCGCTAATGATCGGAGCCCCTGACATGGCATTCCCCCGAATGAACAACATGAGCTTCTGACTCCTTCCCCCATCCTTCCTGCTTCTCCTGGCCTCCTCTGGAGTAGAAGCTGGGGCGGGTACTGGTTGAACTGTCTACCCCCCTCTAGCCGGAAACCTAGCACACGCTGGTGCATCCGTTGACCTAACTATTTTCTCCCTTCACTTAGCTGGTATTTCCTCAATTCTAGGGGCCATCAATTTTATTACAACCATTATTAACATGAAGCCTCCCGCTATTTCCCAATATCAGACCCCTCTGTTTGTATGGGCCGTCCTAATTACAGCTGTCCTGCTACTTCTCTCCCTGCCTGTACTAGCCGCTGGAATTACAATGCTCCTAACAGACCGAAATTTAAATACTACCTTCTTTGACCCCGCAGGAGGAGGTGACCCAATCCTGTACCAACACCTGTTCTGATTCTTC