Siganus unimaculatus | University of the Philippines Mindanao FishDive Project | Marine Biodiversity Database Project
Siganus unimaculatus (Evermann and Seale, 1907)
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Osteichthyes
  • Order » Acanthuriformes
  • Family » Siganidae
  • Genus » Siganus
  • Species » unimaculatus
  • Siganus unimaculatus (Evermann and Seale, 1907)
    (Blotched foxface)
  • Description »  

    Marine; reef-associated; depth range ? - 30 m , usually 1 - 30 m . Tropical; 30°N - 30°S

    Maturity: Lm ?  range ? - ? cm Max length : 20.0 cm SL male/unsexed;

    Dorsal spines (total): 13; Dorsal soft rays (total): 10; Anal spines: 7; Anal soft rays: 9; Vertebrae: 13. Color the same as in S. vulpinus except for the blackish spot posteriorly on the upper side of the body. Caudal peduncle only slightly incised. Spines stout, pungent, and venomous. Preopercular angle 109°-119°. Variable cheek squamation; usually covered with scales, 7-10 rows deep below center of orbit, occasionally a few scattered scales present below eye; a triangular area from lower edge of orbit to angle of mouth always fully scaled. Fully scaled midline of thorax. Body shape (shape guide): short and / or deep;  Cross section: compressed.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [Mati City, Davao Oriental] [Mati City, Davao Oriental]
  • Collectors/Field Observers »   CL Nañola, MA Fortaleza, JJ Lanutan, KL Labrador
  • Species ID by »   Maybelle A. Fortaleza
  • Institution/Project »   University of the Philippines Mindanao FishDive Project
  • Collection Code »   [None] [FDP_MATI_2202_013A]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Data deficient (DD); Date assessed:12 October 2018 (FishBase)
  • Sample Availability and Preservation »   Tissue preserved in 95% ETOH; whole fish specimen fixed in formalin
  • GenBank Accession Number »   OR524679
  • Curated by »   Maybelle Fortaleza
  • Last Updated »   Sept. 15, 2024, 11:02 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GATATCGGCACCCTTTATTTAGTATTTGGTGCTTGAGCCGGAATAGTAGGAACAGCCTTGAGCCTACTGATTCGAGCAGAACTCAGCCAACCAGGCGCCCTCCTTGGAGATGACCAGATTTATAACGTCATTGTTACCGCCCATGCATTCGTAATAATTTTCTTTATAGTAATGCCAATTATGATCGGAGGGTTCGGAAACTGACTAATCCCCCTAATGATCGGGGCCCCCGACATGGCATTCCCACGAATAAACAACATGAGCTTCTGACTTCTACCACCTTCTTTCCTACTTCTCCTAGCCTCCTCCGGAGTAGAAGCCGGGGCAGGAACCGGGTGAACAGTTTATCCTCCTTTAGCTGGCAACCTAGCACACGCTGGCGCATCAGTTGACCTAACCATCTTCTCCCTCCATTTAGCAGGGATTTCCTCAATTCTTGGAGCTATCAACTTCATCACAACCATTATTAACATGAAACCTCCCGCTATTTCCCAGTACCAAACCCCACTATTCGTGTGAGCCGTCCTAATTACAGCTGTCCTTCTACTCCTTTCTCTACCCGTTCTGGCTGCCGGGATTACAATGCTTCTCACAGACCGAAATCTGAACACAACATTCTTTGACCCAGCAGGTGGGGGTGACCCAATTCTATACCAACACCTATTCTGATTCTTC