Siganus unimaculatus | University of the Philippines Mindanao FishDive Project | Marine Biodiversity Database Project
Siganus unimaculatus (Evermann and Seale, 1907)
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Osteichthyes
  • Order » Acanthuriformes
  • Family » Siganidae
  • Genus » Siganus
  • Species » unimaculatus
  • Siganus unimaculatus (Evermann and Seale, 1907)
    (Blotched foxface)
  • Description »   (Wikipedia) The blotched foxface (Siganus unimaculatus), also called the blackblotch foxface or one-spot foxface, is a species of marine ray-finned fish, a rabbitfish belonging to the family Siganidae. It is found at reefs and lagoons in the central Indo-Pacific. Except for the black spot on the rear upper body, it resembles the closely related foxface rabbitfish.
    Full article at Wikipedia
  • Local Name »  
  • Locality/Distribution »   [Mati City, Davao Oriental] [Mati City, Davao Oriental]
  • Collectors/Field Observers »   CL Nañola, MA Fortaleza, JJ Lanutan, KL Labrador
  • Species ID by »   Maybelle A. Fortaleza
  • Institution/Project »   University of the Philippines Mindanao FishDive Project
  • Collection Code »   FDP_MATI_2202_013_A
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Data deficient (DD); Date assessed:12 October 2018 (FishBase)
  • Sample Availability and Preservation »   Tissue preserved in 95% ETOH; whole fish specimen fixed in formalin
  • GenBank Accession Number »   OR524679
  • Curated by »   Maybelle Fortaleza
  • Last Updated »   Sept. 15, 2024, 11:02 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GATATCGGCACCCTTTATTTAGTATTTGGTGCTTGAGCCGGAATAGTAGGAACAGCCTTGAGCCTACTGATTCGAGCAGAACTCAGCCAACCAGGCGCCCTCCTTGGAGATGACCAGATTTATAACGTCATTGTTACCGCCCATGCATTCGTAATAATTTTCTTTATAGTAATGCCAATTATGATCGGAGGGTTCGGAAACTGACTAATCCCCCTAATGATCGGGGCCCCCGACATGGCATTCCCACGAATAAACAACATGAGCTTCTGACTTCTACCACCTTCTTTCCTACTTCTCCTAGCCTCCTCCGGAGTAGAAGCCGGGGCAGGAACCGGGTGAACAGTTTATCCTCCTTTAGCTGGCAACCTAGCACACGCTGGCGCATCAGTTGACCTAACCATCTTCTCCCTCCATTTAGCAGGGATTTCCTCAATTCTTGGAGCTATCAACTTCATCACAACCATTATTAACATGAAACCTCCCGCTATTTCCCAGTACCAAACCCCACTATTCGTGTGAGCCGTCCTAATTACAGCTGTCCTTCTACTCCTTTCTCTACCCGTTCTGGCTGCCGGGATTACAATGCTTCTCACAGACCGAAATCTGAACACAACATTCTTTGACCCAGCAGGTGGGGGTGACCCAATTCTATACCAACACCTATTCTGATTCTTC