Siganus argenteus | University of the Philippines Mindanao FishDive Project | Marine Biodiversity Database Project
Siganus argenteus (Quoy and Gaimard, 1825)
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Osteichthyes
  • Order » Acanthuriformes
  • Family » Siganidae
  • Genus » Siganus
  • Species » argenteus
  • Siganus argenteus (Quoy and Gaimard, 1825)
    (Streamlined spinefoot)
  • Description »  

    Marine; reef-associated; depth range 0 - 40 m , usually 1 - 30 m . Tropical; 25°C - 29°C ; 30°N - 30°S, 32°E - 128°W

    Maturity: Lm ?, range 20 - ? cm Max length : 40.0 cm TL male/unsexed; ; common length : 25.0 cm TL male/unsexed;

    Dorsal spines (total): 13; Dorsal soft rays (total): 10; Anal spines: 7; Anal soft rays: 9; Vertebrae: 13. This species is distinguished by the following characters: juveniles and adults with body oval and compressed, slender, fusiform, greatest body depth 2.4-3 in SL; anterior nostril with a long flap reaching to or past posterior nostril; last dorsal-fin spine very short, 2.6-3.5 times in longest dorsal-fin spine; last anal-fin spine shortest, 2.1-3.1 times in longest (second or third) anal-fin spine; caudal fin deeply forked. Colour of body blue or greyish above, silvery below; variations in markings (spots, curved lines); head and trunk usually covered with small yellow spots, bars, and commas, much larger than interspaces and quarter to 1/2 size of pupil; spots usually joining to form horizontal wavy lines, particularly on lower sides; yellow pectoral-fin axil, usually yellow stripes along base of dorsal fin and a dark brown bar immediately posterior to the upper opercular margin; colours fade rapidly at death so that head and trunk may be solid brown ( Ref. 9813, 90102). Body shape (shape guide): fusiform / normal;  Cross section: compressed.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [Mati City, Davao Oriental] [General Santos City, South Cotabato] [Mati City, Davao Oriental]
  • Collectors/Field Observers »   CL Nañola, MA Fortaleza, JJ Lanutan, KL Labrador
  • Species ID by »   Maybelle A. Fortaleza
  • Institution/Project »   University of the Philippines Mindanao FishDive Project
  • Collection Code »   [None] [FDP_SGES_2112_041B] [FDP_MATI_2202_011A]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:10 March 2015 (FishBase)
  • Sample Availability and Preservation »   Tissue preserved in 95% ETOH; whole fish specimen fixed in formalin
  • GenBank Accession Number »   OR524666
  • Curated by »   Maybelle Fortaleza
  • Last Updated »   Nov. 28, 2024, 12:52 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GATATTGGCACCCCTTATTTAGTACTGGGTGCTTGCGCCGGAATGGTAGGAACAGCTTTAAGCCTACTAATTCGAGCAGAACTTAGCCAACCAGGCGCCCTCCTTGGAGATGACCAGATTTATAACGTCATTGTTACCGCCCATGCATTCGTAATAATTTTCTTTATAGTAATGCCAATTATGATCGGAGGCTTCGGAAACTGACTGATCCCCCTAATGATTGGAGCTCCTGACATGGCATTCCCACGAATGAACAACATGAGCTTCTGACTCCTCCCCCCTTCTTTCTTACTTCTCTTAGCCTCCTCTGGAGTAGAAGCCGGAGCGGGAACCGGGTGAACAGTCTACCCTCCATTAGCTGGTAATCTGGCACACGCTGGGGCATCAGTAGACCTAACTATTTTCTCTTTACATTTAGCTGGAATTTCCTCAATTCTTGGGGCAATTAACTTCATTACAACTATTATTAACATGAAACCTCCCGCTATTTCCCAGTACCAAACGCCTCTGTTCGTATGGGCCGTTCTAATTACAGCTGTCCTGCTTCTTCTTTCCCTACCCGTCTTAGCCGCTGGGATTACAATGCTTCTTACAGATCGAAACTTAAATACTACATTCTTCGACCCAGCAGGGGGAGGAGATCCCATTCTTTATCAACACCTGTTTTGATTCTTC