Siganus punctatus | University of the Philippines Mindanao FishDive Project | Marine Biodiversity Database Project
Siganus punctatus (Schneider and Forster, 1801)
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Osteichthyes
  • Order » Acanthuriformes
  • Family » Siganidae
  • Genus » Siganus
  • Species » punctatus
  • Siganus punctatus (Schneider and Forster, 1801)
    (Goldspotted spinefoot)
  • Description »   (Wikipedia) Siganus punctatus the goldspotted spinefoot, goldspotted rabbitfish, punctuated spinefoot, spotted rabbitfish, spotted spinefoot or yellow-spotted spinefoot, is a species of marine ray-finned fish, a rabbitfish belonging to the family Siganidae. It occurs in the Indo-West Pacific region.
    Full article at Wikipedia
  • Local Name »  
  • Locality/Distribution »   [Governor Generoso, Davao Oriental] [Mati City, Davao Oriental]
  • Collectors/Field Observers »   CL Nañola, MA Fortaleza, KL Labrador, JJ Lanutan
  • Species ID by »   Maybelle A. Fortaleza
  • Institution/Project »   University of the Philippines Mindanao FishDive Project
  • Collection Code »   FDP_GOVG_2202_034_A
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:12 March 2015 (FishBase)
  • Sample Availability and Preservation »   Tissue preserved in 95% ETOH; whole fish specimen fixed in formalin
  • GenBank Accession Number »   OR524676
  • Curated by »   Maybelle Fortaleza
  • Last Updated »   Sept. 15, 2024, 11:03 p.m.
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GATATCGGCACCCTTTATTTAGTATTTGGTGCTTGAGCCGGAATGGTGGGAACAGCCTTAAGCCTACTAATTCGAGCAGAACTCAGCCAACCAGGCGCCCTCCTTGGGGATGACCAGATTTATAACGTCATTGTTACCGCCCATGCATTCGTAATAATTTTCTTTATAGTAATGCCAATTATGATCGGAGGGTTCGGAAACTGACTAATCCCCCTAATGATCGGAGCTCCCGACATGGCATTCCCACGAATGAACAACATGAGCTTCTGACTTCTCCCCCCTTCTTTCCTACTTCTCCTAGCCTCCTCCGGAGTAGAAGCCGGGGCGGGGACCGGGTGAACAGTTTATCCCCCCTTAGCTGGTAACCTAGCACACGCTGGTGCATCAGTCGACCTAACCATCTTCTCCCTTCATTTAGCGGGGATTTCCTCAATTCTTGGAGCTATCAACTTCATCACAACCATTATTAACATGAAACCTCCCGCTATTTCCCAATACCAAACCCCATTATTTGTATGGGCCGTCCTAATTACAGCTGTCCTTCTACTTCTTTCTCTACCCGTTTTGGCTGCCGGGATTACAATGCTTCTCACAGACCGAAATCTGAACACAACATTCTTTGATCCAGCAGGTGGGGGTGACCCAATTCTATACCAACACCTATTCTGATTCTTC

    • Visit FishBase Website
    Visit BOLD Systems Website
    University of the Philippines Mindanao, Mintal, Tugbok District, Davao City © ABRAHAM Program 2024 - All Rights Reserved. 467 visit(s) today - 171531 total visits (346 average daily visits): 2023-05-22 - 2024-09-29 (496 days)