Acanthochromis polyacanthus | University of the Philippines Mindanao FishDive Project | Marine Biodiversity Database Project
Acanthochromis polyacanthus (Bleeker, 1855)
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Osteichthyes
  • Order » Cichliformes
  • Family » Pomacentridae
  • Genus » Acanthochromis
  • Species » polyacanthus
  • Acanthochromis polyacanthus (Bleeker, 1855)
    (Spiny chromis)
  • Description »   (Wikipedia) The spiny chromis (Acanthochromis polyacanthus) is a species of damselfish from the western Pacific. It is the only member of the genus Acanthochromis.
    Full article at Wikipedia
  • Local Name »  
  • Locality/Distribution »   [Santa Cruz, Davao del Sur] [Santa Cruz, Davao del Sur]
  • Collectors/Field Observers »   MA Fortaleza, JJ Lanutan, MC Jandoc, JA Oño
  • Species ID by »   Maybelle A. Fortaleza
  • Institution/Project »   University of the Philippines Mindanao FishDive Project
  • Collection Code »   [None] [FDP_STAC_2211_005A]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:15 November 2010 (FishBase)
  • Sample Availability and Preservation »   Tissue preserved in 95% ETOH; whole fish specimen fixed in formalin
  • GenBank Accession Number »   OR524232
  • Curated by »   Maybelle Fortaleza
  • Last Updated »   Nov. 28, 2024, 1:15 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    ATCGGCACCCTTTATCTAGTATTTGGTGCTTGAGCTGGGATAGTAGGTACAGCTCTAAGCCTTCTCATTCGAGCAGAACTAAGCCAACCAGGTGCACTTTTAGGGGACGACCAAATCTATAACGTCATCGTCACCGCGCACGCCTTCGTAATAATTTTCTTTATAGTAATGCCAATCATAATTGGAGGGTTCGGGAACTGACTAGTGCCTCTTATGATTGGTGCTCCTGACATGGCATTCCCTCGAATGAACAACATGAGCTTCTGACTACTCCCCCCATCATTCCTTCTTCTTCTAGCCTCTTCTGGAGTTGAAGCCGGAGCAGGGACAGGTTGAACCGTGTACCCCCCACTATCTGGAAACCTTGCTCATGCAGGAGCCTCAGTAGACCTCACCATTTTTTCTCTACATCTAGCAGGTATCTCATCCATCCTCGGGGCAATCAACTTTATTACCACCATCATCAACATGAAACCTCCCGCCATTTCACAATATCAAACCCCCCTATTTGTCTGAGCTGTCCTAGTCACTGCTGTCCTTCTTCTCCTATCCCTTCCTGTCCTAGCAGCCGGCATCACTATGCTCCTAACTGACCGAAACCTAAACACCACTTTCTTCGACCCAGCAGGAGGAGGAGACCCAATTCTTTACCAACACCTCTGCTGA