Dascyllus trimaculatus | University of the Philippines Mindanao FishDive Project | Marine Biodiversity Database Project
Dascyllus trimaculatus (Rüppell, 1829)
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Osteichthyes
  • Order » Cichliformes
  • Family » Pomacentridae
  • Genus » Dascyllus
  • Species » trimaculatus
  • Dascyllus trimaculatus (Rüppell, 1829)
    (Threespot dascyllus)
  • Description »  

    Marine; reef-associated; non-migratory; depth range 0 - 55 m . Tropical; 32°N - 36°S, 24°E - 128°W

    Maturity: Lm ?  range ? - ? cm Max length : 14.0 cm TL male/unsexed; ; max. published weight: 45.21 g

    Dorsal spines (total): 12; Dorsal soft rays (total): 14 - 16; Anal spines: 2; Anal soft rays: 14 - 15. Juveniles overall black with scale centers bluish; white blotch on forehead and upper sides; all fins black except the transparent pectoral and outer portion of soft dorsal rays. Geographic and behavioral color of adults variable; no spot on forehead; spot on upper sides very reduced; head and fins normally black; scales with black margins. Margins of preorbital, suborbital and preoperculum finely serrated . Nuptial fish generally paler color. Body depth 1.4-1.6 in SL . Body shape (shape guide): short and / or deep;  Cross section: compressed.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [Santa Cruz, Davao del Sur] [Santa Maria, Davao Occidental] [Santa Cruz, Davao del Sur] [Santa Cruz, Davao del Sur]
  • Collectors/Field Observers »   MA Fortaleza, JJ Lanutan, JA Oño
  • Species ID by »   Maybelle A. Fortaleza
  • Institution/Project »   University of the Philippines Mindanao FishDive Project
  • Collection Code »   [None] [MIN_1910_STAM_017A] [FDP_STAC_2211_024A] [FDP_STAC_2209_012A]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:23 September 2021 (FishBase)
  • Sample Availability and Preservation »   Tissue preserved in 95% ETOH; whole fish specimen fixed in formalin
  • GenBank Accession Number »   OR524360
  • Curated by »   Maybelle Fortaleza
  • Last Updated »   Nov. 28, 2024, 1:22 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GGCACCCTCTATCTAGTATTTGGTGCCTGAGCCGGGATAGTAGGTACAGCCCTAAGCCTGCTTATCCGAGCAGAGCTAAGCCAACCAGGCGCTCTTCTAGGGGACGACCAGATTTATAATGTTATCGTCACAGCGCACGCCTTTGTAATAATTTTCTTTATAGTAATGCCAATTATGATTGGAGGGTTTGGAAACTGGCTGATTCCTCTCATGATCGGAGCCCCTGACATAGCATTCCCTCGGATGAATAATATAAGTTTCTGACTTTTACCCCCTTCATTCCTTCTTCTGCTGGCCTCTTCTGGCGTCGAAGCAGGTGCAGGCACAGGATGAACCGTATACCCTCCCCTATCAGGAAACCTGGCCCATGCAGGAGCTTCCGTAGATCTGACCATTTTCTCGCTCCATCTGGCAGGAATTTCCTCGATCCTTGGAGCAATCAACTTTATTACAACCATCATTAACATAAAACCTCCCGCTATCACCCAATACCAAACTCCTCTTTTCGTGTGAGCTGTCCTTATTACTGCTGTTCTTCTCCTTCTCTCCCTTCCAGTCCTAGCCGCTGGAATTACCATGCTCTTAACTGATCGTAACTTAAATACTACATTTTTTGACCCAGCAGGAGGAGGGGACCCAATCCTCTATCAACATTTATTCTGA