Dascyllus trimaculatus | University of the Philippines Mindanao FishDive Project | Marine Biodiversity Database Project
Dascyllus trimaculatus (Rüppell, 1829)
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Osteichthyes
  • Order » Cichliformes
  • Family » Pomacentridae
  • Genus » Dascyllus
  • Species » trimaculatus
  • Dascyllus trimaculatus (Rüppell, 1829)
    (Threespot dascyllus)
  • Description »   (Wikipedia) The threespot dascyllus (Dascyllus trimaculatus), also known as the domino damsel or simply domino, is a species of damselfish from the family Pomacentridae. It is native to the Indo-Pacific from the Red Sea and East Africa, to the Pitcairn Islands, southern Japan, and Australia, and can also be found in some parts of the Philippines. Its grey to black body has two lateral white spots and one between the eyes like domino hence the name; the threespot dascyllus grows up to 13 cm (5.1 in) in length. Coloration is somewhat variable; the spot on the forehead may be absent and the lateral spots very much reduced. It feeds on algae, copepods and other planktonic crustaceans.
    Full article at Wikipedia
  • Local Name »  
  • Locality/Distribution »   [Santa Cruz, Davao del Sur] [Santa Maria, Davao Occidental] [Santa Cruz, Davao del Sur] [Santa Cruz, Davao del Sur]
  • Collectors/Field Observers »   MA Fortaleza, JJ Lanutan, JA Oño
  • Species ID by »   Maybelle A. Fortaleza
  • Institution/Project »   University of the Philippines Mindanao FishDive Project
  • Collection Code »   FDP_STAC_2209_012_A
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:23 September 2021 (FishBase)
  • Sample Availability and Preservation »   Tissue preserved in 95% ETOH; whole fish specimen fixed in formalin
  • GenBank Accession Number »   OR524360
  • Curated by »   Maybelle Fortaleza
  • Last Updated »   Sept. 15, 2024, 9:33 p.m.
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GGCACCCTCTATCTAGTATTTGGTGCCTGAGCCGGGATAGTAGGTACAGCCCTAAGCCTGCTTATCCGAGCAGAGCTAAGCCAACCAGGCGCTCTTCTAGGGGACGACCAGATTTATAATGTTATCGTCACAGCGCACGCCTTTGTAATAATTTTCTTTATAGTAATGCCAATTATGATTGGAGGGTTTGGAAACTGGCTGATTCCTCTCATGATCGGAGCCCCTGACATAGCATTCCCTCGGATGAATAATATAAGTTTCTGACTTTTACCCCCTTCATTCCTTCTTCTGCTGGCCTCTTCTGGCGTCGAAGCAGGTGCAGGCACAGGATGAACCGTATACCCTCCCCTATCAGGAAACCTGGCCCATGCAGGAGCTTCCGTAGATCTGACCATTTTCTCGCTCCATCTGGCAGGAATTTCCTCGATCCTTGGAGCAATCAACTTTATTACAACCATCATTAACATAAAACCTCCCGCTATCACCCAATACCAAACTCCTCTTTTCGTGTGAGCTGTCCTTATTACTGCTGTTCTTCTCCTTCTCTCCCTTCCAGTCCTAGCCGCTGGAATTACCATGCTCTTAACTGATCGTAACTTAAATACTACATTTTTTGACCCAGCAGGAGGAGGGGACCCAATCCTCTATCAACATTTATTCTGA

    • Visit FishBase Website
    Visit BOLD Systems Website
    University of the Philippines Mindanao, Mintal, Tugbok District, Davao City © ABRAHAM Program 2024 - All Rights Reserved. 1308 visit(s) today - 304794 total visits (553 average daily visits): 2023-05-22 - 2024-11-23 (551 days)