Pygoplites diacanthus | University of the Philippines Mindanao FishDive Project | Marine Biodiversity Database Project
Pygoplites diacanthus (Boddaert, 1772)
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Osteichthyes
  • Order » Acanthuriformes
  • Family » Pomacanthidae
  • Genus » Pygoplites
  • Species » diacanthus
  • Pygoplites diacanthus (Boddaert, 1772)
    (Regal angelfish)
  • Description »   (Wikipedia) The royal angelfish (Pygoplites diacanthus), or regal angelfish, is a species of marine ray-finned fish, a marine angelfish belonging to the family Pomacanthidae, and the monotypic genus Pygoplites. It is found in tropical Indo-Pacific oceans. It can grow as long as 25 cm (9.8 in).
    Full article at Wikipedia
  • Local Name »  
  • Locality/Distribution »   [Mati City, Davao Oriental] [Davao del Norte] [Governor Generoso Davao Oriental] [Mati City, Davao Oriental]
  • Collectors/Field Observers »   CL Nañola, MA Fortaleza, JJ Lanutan, KL Labrador
  • Species ID by »   Maybelle A. Fortaleza
  • Institution/Project »   University of the Philippines Mindanao FishDive Project
  • Collection Code »   FDP_MATI_2202_020_A
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:08 October 2009 (FishBase)
  • Sample Availability and Preservation »   Tissue preserved in 95% ETOH; whole fish specimen fixed in formalin
  • GenBank Accession Number »   OR524610
  • Curated by »   Maybelle Fortaleza
  • Last Updated »   Sept. 15, 2024, 10:41 p.m.
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    ATCGGCACCCTCTATTTATTATTCGGTGCTTGAGCTGGGATAGTAGGAACAGCTTTAAGCCTACTAATTCGAGCAGAGCTAAATCAACCAGGCAGCCTCCTAGGGGATGACCAAATCTACAATGTTATCGTTACAGCACATGCATTCGTAATAATTTTCTTTATAGTCATACCCGCTATAATTGGAGGGTTCGGAAACTGACTAGTTCCCCTAATAATTGGGGCCCCCGACATGGCATTTCCCCGAATAAATAACATAAGCTTTTGACTCCTCCCTCCCTCCCTTCTCCTTCTTCTGGCCTCCGCCGGAGTAGAGGCCGGGGCCGGTACTGGATGAACAGTCTATCCTCCTCTAGCTGGCAACTTAGCTCATGCAGGAGCATCAGTAGACCTAACCATCTTCTCACTTCATCTAGCAGGAGTTTCCTCAATTCTTGGAGCTATTAACTTTATTACTACTATCATTAATATAAAACCCCCTGCCATCTCTCAATATCAAACCCCCCTATTTGTCTGAGCAGTGCTAATTACCGCAGTGCTGCTACTTCTCTCCCTTCCAGTCCTTGCTGCGGGAATCACAATGCTTCTCACAGATCGAAACCTGAATACCACATTCTTTGACCCTGCTGGGGGAGGAGACCCAATTCTTTATCAACACCTATTTTGA

    • Visit FishBase Website
    Visit BOLD Systems Website
    University of the Philippines Mindanao, Mintal, Tugbok District, Davao City © ABRAHAM Program 2024 - All Rights Reserved. 1084 visit(s) today - 304570 total visits (553 average daily visits): 2023-05-22 - 2024-11-23 (551 days)