Epinephelus coioides | University of the Philippines Mindanao FishDive Project | Marine Biodiversity Database Project
Epinephelus coioides (Hamilton, 1822)
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Osteichthyes
  • Order » Perciformes
  • Family » Epinephelidae
  • Genus » Epinephelus
  • Species » coioides
  • Epinephelus coioides (Hamilton, 1822)
    (Orange-spotted grouper)
  • Description »  

    Marine; brackish; reef-associated; depth range 1 - 100 m . Subtropical; 37°N - 34°S, 28°E - 180°E

    Maturity: Lm 41.3, range 25 - 30 cm Max length : 120 cm TL male/unsexed; ; max. published weight: 15.0 kg ; max. reported age: 22 years

    Dorsal spines (total): 11; Dorsal soft rays (total): 13 - 16; Anal spines: 3; Anal soft rays: 8. This species is distinguished by the following characters: elongated body with greatest body depth at 2.9-3.7 in SL (for specimens 10-78 cm SL); head length 2.3-2.6 in SL. interorbital width 5.0-6.2 in HL; preopercle with enlarged serrae at angle and a broad shallow notch just above angle; upper edge of operculum straight or somewhat convex; maxilla reaches to or slightly past a vertical at rear edge of eye; upper jaw length 17-20% of SL; midlateral part of lower jaw with 2-3 rows of subequal teeth; gill rakers of first gill arch 8-10 + 14-17; pyloric caeca 50-60; lateral body scales rough, with minute auxiliary scales (body scales ctenoid except for nape, back, thorax, abdomen and above anal-fin base with cycloid scales); lateral-line scales 58-65; lateral-line tubes of anterior scales branched in adults. Colour: head and body tan dorsally, shading to whitish ventrally; numerous small brownish orange or reddish brown spots on head, body, and median fins; body with 5 faint, irregular, oblique, dark bars which bifurcate ventrally (irregular H-shaped bars); back with 3-4 blackish saddles; orange spots become poorly defined and darker with growth ( Ref. 39231, 90102). Body shape (shape guide): fusiform / normal;  Cross section: compressed.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [Toril, Davao City, Davao del Sur] [Toril, Davao City, Davao del Sur]
  • Collectors/Field Observers »   MA Fortaleza, JJ Lanutan, JA Oño
  • Species ID by »   Maybelle A. Fortaleza
  • Institution/Project »   University of the Philippines Mindanao FishDive Project
  • Collection Code »   [None] [FDP_TORL_2209_002A]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:21 November 2016 (FishBase)
  • Sample Availability and Preservation »   Tissue preserved in 95% ETOH; whole fish specimen fixed in formalin
  • GenBank Accession Number »   OR524382
  • Curated by »   Maybelle Fortaleza
  • Last Updated »   Sept. 16, 2024, 9:08 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    ATTGGCACCCTTTATCTTGTATTTGGTGCCTGAGCGGGAATAGTAGGAACAGCCCTTAGCCTACTAATTCGAGCTGAGCTAAGCCAGCCGGGAGCTCTACTAGGCGACGACCAGATCTATAATGTAATTGTTACAGCACATGCTTTTGTAATAATCTTTTTTATAGTAATACCAATTATGATTGGTGGCTTTGGAAACTGACTTATTCCACTTATAATCGGTGCCCCAGACATAGCATTCCCTCGAATGAATAATATAAGCTTCTGACTCCTTCCCCCATCCTTCCTGCTTCTTCTTGCCTCTTCTGGTGTAGAAGCCGGTGCTGGCACTGGCTGAACAGTCTACCCACCCCTGGCCGGAAACCTAGCCCACGCAGGTGCATCAGTAGACTTAACTATTTTCTCACTACATTTAGCGGGTATTTCATCAATTCTAGGCGCAATCAACTTTATCACAACCATCATTAACATGAAACCTCCTGCTACCTCTCAATACCAAACACCTTTATTTGTGTGAGCAGTATTGATTACAGCAGTACTCCTACTCCTTTCCCTTCCCGTCCTTGCCGCCGGCATCACAATGCTACTCACTGATCGTAATCTTAATACCACTTTCTTTGACCCAGCCGGAGGGGGAGACCCGATTCTTTACCAGCACTTATTTTGA