Epinephelus coioides | University of the Philippines Mindanao FishDive Project | Marine Biodiversity Database Project
Epinephelus coioides (Hamilton, 1822)
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Osteichthyes
  • Order » Perciformes
  • Family » Epinephelidae
  • Genus » Epinephelus
  • Species » coioides
  • Epinephelus coioides (Hamilton, 1822)
    (Orange-spotted grouper)
  • Description »   (Wikipedia) The orange-spotted grouper (Epinephelus coioides), also known as the brown-spotted rockcod, estuary cod, estuary rockcod, goldspotted rockcod, greasy cod, North-west groper, orange spotted cod or blue-and-yellow grouper, is a species of marine ray-finned fish, a grouper from the subfamily Epinephelinae which is part of the family Serranidae, which also includes the anthias and sea basses. It has an Indo-Pacific distribution and is found in marine and brackish waters.
    Full article at Wikipedia
  • Local Name »  
  • Locality/Distribution »   [Toril, Davao City, Davao del Sur] [Toril, Davao City, Davao del Sur]
  • Collectors/Field Observers »   MA Fortaleza, JJ Lanutan, JA Oño
  • Species ID by »   Maybelle A. Fortaleza
  • Institution/Project »   University of the Philippines Mindanao FishDive Project
  • Collection Code »   FDP_TORL_2209_002_A
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:21 November 2016 (FishBase)
  • Sample Availability and Preservation »   Tissue preserved in 95% ETOH; whole fish specimen fixed in formalin
  • GenBank Accession Number »   OR524382
  • Curated by »   Maybelle Fortaleza
  • Last Updated »   Sept. 16, 2024, 9:08 p.m.
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    ATTGGCACCCTTTATCTTGTATTTGGTGCCTGAGCGGGAATAGTAGGAACAGCCCTTAGCCTACTAATTCGAGCTGAGCTAAGCCAGCCGGGAGCTCTACTAGGCGACGACCAGATCTATAATGTAATTGTTACAGCACATGCTTTTGTAATAATCTTTTTTATAGTAATACCAATTATGATTGGTGGCTTTGGAAACTGACTTATTCCACTTATAATCGGTGCCCCAGACATAGCATTCCCTCGAATGAATAATATAAGCTTCTGACTCCTTCCCCCATCCTTCCTGCTTCTTCTTGCCTCTTCTGGTGTAGAAGCCGGTGCTGGCACTGGCTGAACAGTCTACCCACCCCTGGCCGGAAACCTAGCCCACGCAGGTGCATCAGTAGACTTAACTATTTTCTCACTACATTTAGCGGGTATTTCATCAATTCTAGGCGCAATCAACTTTATCACAACCATCATTAACATGAAACCTCCTGCTACCTCTCAATACCAAACACCTTTATTTGTGTGAGCAGTATTGATTACAGCAGTACTCCTACTCCTTTCCCTTCCCGTCCTTGCCGCCGGCATCACAATGCTACTCACTGATCGTAATCTTAATACCACTTTCTTTGACCCAGCCGGAGGGGGAGACCCGATTCTTTACCAGCACTTATTTTGA

    • Visit FishBase Website
    Visit BOLD Systems Website
    University of the Philippines Mindanao, Mintal, Tugbok District, Davao City © ABRAHAM Program 2024 - All Rights Reserved. 74 visit(s) today - 305005 total visits (553 average daily visits): 2023-05-22 - 2024-11-24 (552 days)