Cephalopholis sonnerati | University of the Philippines Mindanao FishDive Project | Marine Biodiversity Database Project
Cephalopholis sonnerati (Valenciennes, 1828)
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Osteichthyes
  • Order » Perciformes
  • Family » Epinephelidae
  • Genus » Cephalopholis
  • Species » sonnerati
  • Cephalopholis sonnerati (Valenciennes, 1828)
    (Tomato hind)
  • Description »   (Wikipedia) Cephalopholis sonnerati, known as the tomato hind, tomato rockcod, or tomato cod, is a species of marine ray-finned fish, a grouper from the subfamily Epinephelinae which is in the family Serranidae which also includes the anthias and sea basses. It is distributed on coral reefs in the tropical Indo-Pacific. It is also sometimes called the orange-spotted cod, red coral cod, red rockcod, tomato grouper, or tomato seabass.
    Full article at Wikipedia
  • Local Name »  
  • Locality/Distribution »   [Toril, Davao City] [Toril, Davao del Sur, Davao City]
  • Collectors/Field Observers »   MA Fortaleza, MC Jandoc, JA Oño
  • Species ID by »   Maybelle A. Fortaleza
  • Institution/Project »   University of the Philippines Mindanao FishDive Project
  • Collection Code »   FDP_TORL_2206_013_A
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:15 November 2017 (FishBase)
  • Sample Availability and Preservation »   Tissue preserved in 95% ETOH; whole fish specimen fixed in formalin
  • GenBank Accession Number »   OR524304
  • Curated by »   Maybelle Fortaleza
  • Last Updated »   Sept. 15, 2024, 6:40 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GATATCGGCACCCTTTATCTAGTATTTGGTGCCTGGGCCGGTATAGTGGGGACGGCTCTCAGCCTATTAATCCGGGCCGAGCTAAGCCAACCAGGCGCTTTACTCGGCGATGATCAAATCTACAATGTAATTGTTACGGCACATGCTTTCGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGTGGGTTCGGAAACTGACTTATTCCATTAATAATTGGTGCTCCCGATATAGCATTCCCTCGAATGAATAATATGAGCTTCTGGCTCCTCCCTCCATCCTTCCTACTTCTGCTAGCCTCCTCTGGAGTAGAAGCCGGTGCTGGTACTGGTTGAACAGTATATCCACCCTTAGCCGGTAACCTAGCCCACGCAGGTGCCTCTGTTGACTTAACTATCTTCTCCCTGCATTTAGCAGGAATCTCATCAATTTTAGGGGCAATTAACTTTATTACCACCATTATTAACATAAAACCTCCTGCCATCTCTCAATACCAAACACCCCTATTTGTCTGAGCCGTACTCATCACAGCCGTCCTTCTTCTACTCTCCCTCCCTGTTCTCGCCGCCGGTATTACAATGCTCCTAACAGATCGAAATCTTAACACTACCTTCTTCGACCCTGCTGGAGGAGGAGACCCAATCCTTTACCAACATCTGTTCTGATTCTTC

  • Standard Length (cm) »
    25
  • Weight (grams) »
    300
  • Total Length (cm) »
    30
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116