Epinephelus fasciatus | University of the Philippines Mindanao FishDive Project | Marine Biodiversity Database Project
Epinephelus fasciatus (Forsskål, 1775)
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Osteichthyes
  • Order » Perciformes
  • Family » Epinephelidae
  • Genus » Epinephelus
  • Species » fasciatus
  • Epinephelus fasciatus (Forsskål, 1775)
    (Blacktip grouper)
  • Description »  

    Marine; brackish; reef-associated; depth range 4 - 160 m , usually 20 - 45 m . Tropical; 36°N - 35°S, 22°E - 124°W

    Maturity: Lm ?, range 16 - ? cm Max length : 52.0 cm TL male/unsexed; ; common length : 22.0 cm TL male/unsexed; ; max. published weight: 2.0 kg

    Dorsal spines (total): 11; Dorsal soft rays (total): 15 - 17; Anal spines: 3; Anal soft rays: 8. This species is distinguished by the following characters: body depth 2.8-3.3 in SL (for specimens 10-26 cm SL); head length 2.3-2.6 in SL; flat interorbital area, convex dorsal head profile; snout length 4.3-5.1 in HL; preopercle rounded, rear edge serrate, with lower most serrae slightly enlarged; upper edge of operculum straight; midlateral part of lower jaw with 2-4 rows of teeth; gill rakers of first gill arch 6-8 + 15-17; pyloric caeca 10-16; caudal fin slightly to moderately rounded ( Central- Pacific often with truncate caudal fins); ctenoid scales on body except cycloid anterodorsally above lateral line and on thorax and ventrally on abdomen, with numerous auxiliary scales; nape and dorsoposterior part of head densely covered with minute auxiliary scales; lateral-line scales 49-75. Colour variable, ranging from pale greenish grey to pale reddish yellow to scarlet; body often with 5 or 6 faint dark bars, the last on peduncle; body scales (except ventrally) with pale centre and dark rear margin, producing a faint checked pattern; the outer triangular part of interspinous membranes of dorsal fin black (dark red in fish from Western Australia and in some specimens from deep water), with pale yellow or white spot behind tip of each spine ( Ref. 39231, 89707, 90102). Body shape (shape guide): fusiform / normal;  Cross section: compressed.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [General Santos City, South Cotabato] [General Santos City, South Cotabato]
  • Collectors/Field Observers »   CL Nañola, MA Fortaleza, JJ Lanutan, KL Labrador
  • Species ID by »   Maybelle A. Fortaleza
  • Institution/Project »   University of the Philippines Mindanao FishDive Project
  • Collection Code »   [None] [FDP_SGES_2112_007A]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:21 November 2016 (FishBase)
  • Sample Availability and Preservation »   Tissue preserved in 95% ETOH; whole fish specimen fixed in formalin
  • GenBank Accession Number »   OR524384
  • Curated by »   Maybelle Fortaleza
  • Last Updated »   Sept. 15, 2024, 10:24 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GATATCGGCACCCTCTATCTTGTATTCGGTGCCTGAGCCGGTATAGTAGGAACAGCTCTCAGCCTGCTTATTCGAGCTGAGCTGAGTCAGCCAGGAGCCCTACTCGGCGACGACCAAATTTATAATGTAATCGTTACAGCACATGCTTTCGTAATAATTTTCTTTATAGTAATACCAATCATGATTGGAGGCTTTGGAAACTGACTCATCCCACTTATGATCGGCGCCCCAGATATAGCATTCCCTCGAATAAATAATATAAGCTTCTGGCTTCTCCCACCATCTTTCCTCCTTCTTCTCGCCTCTTCCGGGGTAGAAGCTGGAGCCGGCACTGGCTGAACAGTCTACCCACCTCTGGCTGGAAACCTGGCCCATGCAGGTGCATCTGTAGACTTAACCATCTTCTCACTACACTTAGCAGGGATTTCATCAATTCTGGGGGCTATCAACTTTATTACAACTATTATTAACATAAAACCTCCTGCTATCTCTCAGTATCAAACACCTTTATTCGTCTGAGCTGTCCTAATTACAGCAGTACTCCTGCTCCTATCCCTTCCCGTGCTTGCTGCCGGCATCACTATACTTCTTACAGATCGTAATCTTAACACTACTTTCTTTGATCCAGCTGGAGGAGGAGATCCTATTCTCTACCAACACCTATTCTGATTCTTC