Epinephelus fasciatus | University of the Philippines Mindanao FishDive Project | Marine Biodiversity Database Project
Epinephelus fasciatus (Forsskål, 1775)
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Osteichthyes
  • Order » Perciformes
  • Family » Epinephelidae
  • Genus » Epinephelus
  • Species » fasciatus
  • Epinephelus fasciatus (Forsskål, 1775)
    (Blacktip grouper)
  • Description »   (Wikipedia) The blacktip grouper (Epinephelus fasciatus), also known as the redbanded grouper, blacktipped cod, black-tipped rockcod, footballer cod, red-barred cod, red-barred rockcod, scarlet rock-cod or weathered rock-cod, is a species of marine ray-finned fish, a grouper from the subfamily Epinephelinae which is part of the family Serranidae, which also includes the anthias and sea basses. It is found in the tropical Indo-Pacific region. It is the type species of the genus Epinephelus.
    Full article at Wikipedia
  • Local Name »  
  • Locality/Distribution »   [General Santos City, South Cotabato] [General Santos City, South Cotabato]
  • Collectors/Field Observers »   CL Nañola, MA Fortaleza, JJ Lanutan, KL Labrador
  • Species ID by »   Maybelle A. Fortaleza
  • Institution/Project »   University of the Philippines Mindanao FishDive Project
  • Collection Code »   FDP_SGES_2112_007_A
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:21 November 2016 (FishBase)
  • Sample Availability and Preservation »   Tissue preserved in 95% ETOH; whole fish specimen fixed in formalin
  • GenBank Accession Number »   OR524384
  • Curated by »   Maybelle Fortaleza
  • Last Updated »   Sept. 15, 2024, 10:24 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GATATCGGCACCCTCTATCTTGTATTCGGTGCCTGAGCCGGTATAGTAGGAACAGCTCTCAGCCTGCTTATTCGAGCTGAGCTGAGTCAGCCAGGAGCCCTACTCGGCGACGACCAAATTTATAATGTAATCGTTACAGCACATGCTTTCGTAATAATTTTCTTTATAGTAATACCAATCATGATTGGAGGCTTTGGAAACTGACTCATCCCACTTATGATCGGCGCCCCAGATATAGCATTCCCTCGAATAAATAATATAAGCTTCTGGCTTCTCCCACCATCTTTCCTCCTTCTTCTCGCCTCTTCCGGGGTAGAAGCTGGAGCCGGCACTGGCTGAACAGTCTACCCACCTCTGGCTGGAAACCTGGCCCATGCAGGTGCATCTGTAGACTTAACCATCTTCTCACTACACTTAGCAGGGATTTCATCAATTCTGGGGGCTATCAACTTTATTACAACTATTATTAACATAAAACCTCCTGCTATCTCTCAGTATCAAACACCTTTATTCGTCTGAGCTGTCCTAATTACAGCAGTACTCCTGCTCCTATCCCTTCCCGTGCTTGCTGCCGGCATCACTATACTTCTTACAGATCGTAATCTTAACACTACTTTCTTTGATCCAGCTGGAGGAGGAGATCCTATTCTCTACCAACACCTATTCTGATTCTTC