Cephalopholis leopardus | University of the Philippines Mindanao FishDive Project | Marine Biodiversity Database Project
Cephalopholis leopardus (Lacepède, 1801)
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Osteichthyes
  • Order » Perciformes
  • Family » Epinephelidae
  • Genus » Cephalopholis
  • Species » leopardus
  • Cephalopholis leopardus (Lacepède, 1801)
    (Leopard hind)
  • Description »  

    Marine; reef-associated; non-migratory; depth range 0 - 40 m , usually 3 - 20 m . Tropical; 31°N - 20°S, 40°E - 148°W

    Maturity: Lm ?  range ? - ? cm Max length : 24.0 cm TL male/unsexed; ; max. published weight: 35.64 g

    Dorsal spines (total): 9; Dorsal soft rays (total): 13 - 15; Anal spines: 3; Anal soft rays: 9 - 10. Resembles C. urodeta, but always has a distinctive dark saddle on caudal peduncle ; characterized further by reddish brown head with numerous red-orange or pinkish red spots, extending to pectoral region; mottled pinkish brown body; upper caudal-fin base with large dark brown saddle with smaller saddle just behind; upper part of caudal fin with dark brown streak, less intense streak on lower part; ctenoid scales on body including abdomen; greatest depth of body 2.6-2.9 in SL; rounded caudal fin; pelvic fins, 2.0-2.3 in head length . Body shape (shape guide): fusiform / normal;  Cross section: oval.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [Governor Generoso, Davao Oriental] [Governor Generoso Davao Oriental]
  • Collectors/Field Observers »   MA Fortaleza, JJ Lanutan, MC Jandoc, JA Oño
  • Species ID by »   Maybelle A. Fortaleza
  • Institution/Project »   University of the Philippines Mindanao FishDive Project
  • Collection Code »   [None] [MIN_1908_GOVG_047A]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:02 November 2017 (FishBase)
  • Sample Availability and Preservation »   Tissue preserved in 95% ETOH; whole fish specimen fixed in formalin
  • GenBank Accession Number »   OR524296
  • Curated by »   Maybelle Fortaleza
  • Last Updated »   Sept. 15, 2024, 5:18 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    TGCACCCTCTATCTAGTATTTGGTGCCTGAGCCGGTATAGTGGGAACAGCCCTCAGCCTACTAATCCGGGCTGAACTAAGCCAACCAGGTGCTTTACTCGGCGATGATCAAATCTATAATGTGATTGTTACAGCACATGCTTTCGTAATAATTTTCTTTATAGTAATACCAATTATGATCGGTGGATTCGGAAACTGACTTATTCCACTAATAATTGGTGCCCCGGATATAGCATTCCCCCGAATGAACAACATGAGCTTCTGGCTTCTCCCCCCATCCTTCCTACTTCTGCTAGCCTCCTCTGGAGTAGAAGCTGGTGCTGGTACTGGTTGAACGGTGTATCCACCCTTAGCCGGTAACCTAGCCCACGCAGGTGCCTCTGTTGATCTAACCATCTTTTCTCTACATTTAGCAGGGATCTCATCAATTCTAGGAGCTATCAACTTCATTACTACCATTATTAACATAAAACCCCCTGCCATCTCCCAATACCAAACACCCTTATTTGTTTGAGCTGTATTAATTACAGCCGTTCTTCTCCTTCTCTCTCTTCCTGTCCTTGCTGCCGGTATTACAATGCTTTTAACAGACCGAAATCTTAATACTACCTTCTTCGACCCTGCCGGTGGGGGAGACCCGATCCTTTACCAACACCTATTCTGA