Nemipterus zysron | University of the Philippines Mindanao FishDive Project | Marine Biodiversity Database Project
Nemipterus zysron (Bleeker, 1856)
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Osteichthyes
  • Order » Acanthuriformes
  • Family » Nemipteridae
  • Genus » Nemipterus
  • Species » zysron
  • Nemipterus zysron (Bleeker, 1856)
    (Slender threadfin bream)
  • Description »  

    Marine; demersal; non-migratory; depth range 10 - 125 m . Tropical; 37°N - 30°S, 31°E - 176°W

    Maturity: Lm ?  range ? - ? cm Max length : 34.0 cm TL male/unsexed; ; common length : 21.0 cm TL male/unsexed; ; max. published weight: 395.00 g

    Dorsal spines (total): 10; Dorsal soft rays (total): 9; Anal spines: 3; Anal soft rays: 7. Suborbital spine absent. Preopercle with 3 transverse scale rows. Pectoral and pelvic fins short, reaching to just short of level of anus. A line drawn up from posterior edge of suborbital reaching the dorsal profile about 2 to 6 scale rows before origin of dorsal fin. Upper lobe of caudal fin produced into a long yellow trailing filament. Axillary scale present. Color: Upper body reddish, silvery below. Yellow stripes in front of eye through nostrils, and from upper lip to beneath eye. Less distinct golden stripe from behind eye to origin of lateral line. Body shape (shape guide): fusiform / normal;  Cross section: oval.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [Toril, Davao City, Davao del Sur] [Toril, Davao City, Davao del Sur] [Sasa, Davao City, Davao del Sur]
  • Collectors/Field Observers »   MA Fortaleza, JJ Lanutan, MC Jandoc, JA Oño
  • Species ID by »   Maybelle A. Fortaleza
  • Institution/Project »   University of the Philippines Mindanao FishDive Project
  • Collection Code »   [FDP_TORL_2207_009A] [MIN_1912_TORL_019A] [FDP_IGCS_2111_023A]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:03 March 2015 (FishBase)
  • Sample Availability and Preservation »   Tissue preserved in 95% ETOH; whole fish specimen fixed in formalin
  • GenBank Accession Number »   OR524525
  • Curated by »   Maybelle Fortaleza
  • Last Updated »   Nov. 28, 2024, 12:40 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GGCACCCTCTATCTCTTATTTGGTGCTTGAGCCGGTATAGTCGGGACTGCTCTTAGCCTATTAATTCGGGCTGAATTAAGCCAACCAGGCGCCCTCTTAGGAGATGACCAGATCTATAATGTTATTGTGACAGCTCACGCTTTCGTAATAATTTTCTTTATAGTAATGCCAATTATGATTGGCGGGTTTGGAAATTGATTAATTCCACTCATGATTGGTGCTCCGGATATGGCATTCCCCCGTATAAACAATATAAGCTTCTGACTTCTTCCCCCTTCATTTCTTCTCCTCCTTGCTTCTTCAGGAATTGAAGCAGGCGCAGGAACAGGTTGAACAGTTTACCCGCCCCTTGCAGGCAACTTAGCCCATGCAGGAGCATCTGTTGACTTAACTATCTTCTCGCTTCATCTGGCAGGTATTTCCTCAATCCTGGGAGCCATTAATTTTATTACAACCATCGTTAACATAAAACCCCCTGCTATTTCCCAATATCAAACGCCTCTCTTCGTATGGGCAGTCCTAATTACAGCTGTCCTTCTCCTCCTCTCTCTCCCTGTTTTAGCAGCTGGTATTACAATACTATTAACTGACCGTAATTTAAATACAACTTTCTTTGACCCAGCAGGGGGTGGAGACCCCATCCTTTACCAACATCTTTTCTGA