Nemipterus hexodon | University of the Philippines Mindanao FishDive Project | Marine Biodiversity Database Project
Nemipterus hexodon (Quoy and Gaimard, 1824)
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Osteichthyes
  • Order » Acanthuriformes
  • Family » Nemipteridae
  • Genus » Nemipterus
  • Species » hexodon
  • Nemipterus hexodon (Quoy and Gaimard, 1824)
    (Ornate threadfin bream)
  • Description »  

    Marine; demersal; non-migratory; depth range 10 - 80 m . Tropical; 27°N - 28°S, 93°E - 165°E

    Maturity: Lm ?  range ? - ? cm Max length : 23.0 cm SL male/unsexed; ; common length : 15.0 cm SL male/unsexed;

    Dorsal spines (total): 10; Dorsal soft rays (total): 9; Anal spines: 3; Anal soft rays: 7. Suborbital spine absent. Preopercle with 3 transverse scale rows. Pectoral fins long, reaching to or beyond level of anus. Pelvic fins very long, reaching to or just beyond level of anus. A line drawn up from posterior edge of suborbital reaching the dorsal profile at about 2 to 6 scale rows before origin of dorsal fin. Upper lobe of caudal fin slightly longer than lower, tipped with yellow. Females predominate at small sizes, males at larger sizes. Axillary scale present. Color: Upper body pinkish, silvery white below. Body shape (shape guide): fusiform / normal;  Cross section: oval.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [Toril, Davao City, Davao del Sur] [Toril, Davao City, Davao del Sur]
  • Collectors/Field Observers »   MA Fortaleza, MC Jandoc, JA Oño
  • Species ID by »   Maybelle A. Fortaleza
  • Institution/Project »   University of the Philippines Mindanao FishDive Project
  • Collection Code »   [None] [FDP_TORL_2206_009A]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:03 March 2015 (FishBase)
  • Sample Availability and Preservation »   Tissue preserved in 95% ETOH; whole fish specimen fixed in formalin
  • GenBank Accession Number »   OR524519
  • Curated by »   Maybelle Fortaleza
  • Last Updated »   Nov. 28, 2024, 1:25 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GATATCGGCACCCTTTATCTCTTATTTGGTGCCTGGGCCGGTATAGTAGGGACCGCGTTAAGTCTGTTAATTCGAGCAGAACTTAGCCAACCAGGAGCCCTTTTAGGCGACGACCAAATTTATAATGTCATTGTTACGGCTCACGCTTTTGTAATAATTTTCTTTATAGTAATACCAATTATGATCGGCGGGTTTGGAAACTGATTGATCCCACTCATGATCGGGGCCCCTGATATGGCATTTCCCCGAATAAATAACATGAGCTTCTGACTCTTACCCCCTTCTTTCCTCTTACTTCTCGCCTCATCTGGCATTGAAGCAGGAGCAGGAACAGGTTGGACAGTATATCCCCCTCTTGCAGGAAACCTGGCACACGCAGGAGCATCTGTTGACTTAACTATTTTTTCACTTCACCTAGCCGGTATTTCTTCAATTTTAGGAGCTATTAACTTCATCACTACCATTATTAACATGAAACCTCCAGCCATTTCCCAGTACCAAACGCCCCTATTCGTATGGGCAGTACTAATTACAGCCGTTCTACTCCTTCTTTCTCTTCCTGTCTTAGCAGCCGGGATTACAATGCTCCTAACCGACCGCAACCTAAATACAACCTTCTTTGACCCCGCAGGAGGAGGAGACCCCATTCTTTATCAACATCTCTGCTGATTCTTC