Nemipterus nematopus | University of the Philippines Mindanao FishDive Project | Marine Biodiversity Database Project
Nemipterus nematopus (Bleeker, 1851)
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Osteichthyes
  • Order » Acanthuriformes
  • Family » Nemipteridae
  • Genus » Nemipterus
  • Species » nematopus
  • Nemipterus nematopus (Bleeker, 1851)
    (Yellow-tipped threadfin bream)
  • Description »   (Wikipedia) Nemipterus is a genus of marine ray-finned fishes belonging to the family Nemipteridae, the threadfin and whiptail breams. These fishes are found in the Indian and Pacific Oceans, but now also occur in the Mediterranean Sea due to Lessepsian migration.
    Full article at Wikipedia
  • Local Name »  
  • Locality/Distribution »   [Toril, Davao City, Davao del Sur] [Toril, Davao City, Davao del Sur]
  • Collectors/Field Observers »   MA Fortaleza, MC Jandoc, JA Oño
  • Species ID by »   Maybelle A. Fortaleza
  • Institution/Project »   University of the Philippines Mindanao FishDive Project
  • Collection Code »   FDP_TORL_2206_008_A
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:16 July 2020 (FishBase)
  • Sample Availability and Preservation »   Tissue preserved in 95% ETOH; whole fish specimen fixed in formalin
  • GenBank Accession Number »   OR524521
  • Curated by »   Maybelle Fortaleza
  • Last Updated »   Sept. 15, 2024, 8:41 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GATATCGGCACCCTCTATCTCTTATTTGGTGCTTGGGCCGGCATAGTAGGGACTGCACTAAGTCTGCTTATCCGAGCTGAACTAAGTCAACCAGGAGCTCTTTTAGGCGACGACCAGATTTATAATGTCATTGTAACGGCTCACGCTTTTGTAATAATTTTCTTTATAGTAATACCAATTATGATCGGCGGGTTCGGAAATTGATTAGTCCCACTAATAATCGGAGCCCCTGATATGGCATTTCCCCGAATAAATAATATGAGCTTCTGGCTCTTACCCCCCTCTTTCCTTCTACTTCTTGCCTCATCTGGCATTGAAGCGGGGGCAGGAACAGGTTGAACAGTCTACCCCCCTCTTGCAGGAAACTTAGCGCATGCAGGAGCATCTGTTGATTTAACTATTTTCTCCCTTCACCTGGCTGGGATTTCTTCGATCTTAGGGGCTATTAACTTTATTACTACTATTTTCAACATGAAACCCCCAGCCATCTCGCAATACCAAACGCCCCTATTCGTCTGAGCAGTCCTCATTACAGCCGTTCTCCTTCTCCTTTCCCTTCCTGTTTTAGCAGCCGGCATTACAATGCTTTTAACTGACCGAAATTTAAACACAACTTTCTTTGACCCTGCAGGCGGGGGAGATCCTATTCTTTATCAACATCTTTTCTGATTCTTC