Nemipterus nematopus | University of the Philippines Mindanao FishDive Project | Marine Biodiversity Database Project
Nemipterus nematopus (Bleeker, 1851)
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Osteichthyes
  • Order » Acanthuriformes
  • Family » Nemipteridae
  • Genus » Nemipterus
  • Species » nematopus
  • Nemipterus nematopus (Bleeker, 1851)
    (Yellow-tipped threadfin bream)
  • Description »  

    Marine; demersal; non-migratory; depth range 30 - 102 m . Tropical; 17°N - 19°S, 114°E - 147°E

    Maturity: Lm ?  range ? - ? cm Max length : 17.5 cm SL male/unsexed; ; common length : 15.0 cm SL male/unsexed;

    Dorsal spines (total): 10; Dorsal soft rays (total): 9; Anal spines: 3; Anal soft rays: 7. Lower edge of eye touching or above a line drawn from the tip of snout to the upper base of the pectoral fin. Suborbital shallow, with a slightly emarginate lower edge. Dorsal fin origin about 2-6 scale rows from an imaginary line projected upwards from the posterior edge of the suborbital to dorsal profile. Relatively high soft dorsal fin, with the posterior rays the longest among the Nemipterus species. Upper lobe of caudal fin pointed and bright sulphur-yellow. Axillary scale present. Color: Pinkish head and body with mauve reflections, becoming pearly white on the ventral side. Body shape (shape guide): fusiform / normal;  Cross section: oval.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [Toril, Davao City, Davao del Sur] [Toril, Davao City, Davao del Sur]
  • Collectors/Field Observers »   MA Fortaleza, MC Jandoc, JA Oño
  • Species ID by »   Maybelle A. Fortaleza
  • Institution/Project »   University of the Philippines Mindanao FishDive Project
  • Collection Code »   [None] [FDP_TORL_2206_008A]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:16 July 2020 (FishBase)
  • Sample Availability and Preservation »   Tissue preserved in 95% ETOH; whole fish specimen fixed in formalin
  • GenBank Accession Number »   OR524521
  • Curated by »   Maybelle Fortaleza
  • Last Updated »   Nov. 28, 2024, 1:24 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GATATCGGCACCCTCTATCTCTTATTTGGTGCTTGGGCCGGCATAGTAGGGACTGCACTAAGTCTGCTTATCCGAGCTGAACTAAGTCAACCAGGAGCTCTTTTAGGCGACGACCAGATTTATAATGTCATTGTAACGGCTCACGCTTTTGTAATAATTTTCTTTATAGTAATACCAATTATGATCGGCGGGTTCGGAAATTGATTAGTCCCACTAATAATCGGAGCCCCTGATATGGCATTTCCCCGAATAAATAATATGAGCTTCTGGCTCTTACCCCCCTCTTTCCTTCTACTTCTTGCCTCATCTGGCATTGAAGCGGGGGCAGGAACAGGTTGAACAGTCTACCCCCCTCTTGCAGGAAACTTAGCGCATGCAGGAGCATCTGTTGATTTAACTATTTTCTCCCTTCACCTGGCTGGGATTTCTTCGATCTTAGGGGCTATTAACTTTATTACTACTATTTTCAACATGAAACCCCCAGCCATCTCGCAATACCAAACGCCCCTATTCGTCTGAGCAGTCCTCATTACAGCCGTTCTCCTTCTCCTTTCCCTTCCTGTTTTAGCAGCCGGCATTACAATGCTTTTAACTGACCGAAATTTAAACACAACTTTCTTTGACCCTGCAGGCGGGGGAGATCCTATTCTTTATCAACATCTTTTCTGATTCTTC