Nemipterus nematophorus | University of the Philippines Mindanao FishDive Project | Marine Biodiversity Database Project
Nemipterus nematophorus (Bleeker, 1854)
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Osteichthyes
  • Order » Acanthuriformes
  • Family » Nemipteridae
  • Genus » Nemipterus
  • Species » nematophorus
  • Nemipterus nematophorus (Bleeker, 1854)
    (Doublewhip threadfin bream)
  • Description »  

    Marine; demersal; non-migratory; depth range ? - 75 m . Tropical; 23°N - 9°S, 78°E - 126°E

    Maturity: Lm ?  range ? - ? cm Max length : 20.0 cm SL male/unsexed; ; common length : 15.0 cm SL male/unsexed;

    Dorsal spines (total): 10; Dorsal soft rays (total): 9; Anal spines: 3; Anal soft rays: 7. Suborbital spine absent. Preopercle with 3 transverse scale rows. Pectoral and pelvic fins long, reaching to between level of anus and origin of anal fin. First two dorsal spines close together, almost fused, forming a very long filament. Upper lobe of caudal fin produced to form a trailing filament. A line drawn up from the posterior edge of suborbital reaching the dorsal profile about 2 to 5 scale rows before origin of dorsal fin. Axillary scale present. Color: Head and body pinkish, silvery-white below. Body shape (shape guide): fusiform / normal;  Cross section: compressed.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [Toril, Davao City, Davao del Sur] [Toril, Davao City, Davao del Sur]
  • Collectors/Field Observers »   MA Fortaleza, MC Jandoc, JA Oño
  • Species ID by »   Maybelle A. Fortaleza
  • Institution/Project »   University of the Philippines Mindanao FishDive Project
  • Collection Code »   [None] [MIN_1912_TORL_016A]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:28 June 2018 (FishBase)
  • Sample Availability and Preservation »   Tissue preserved in 95% ETOH; whole fish specimen fixed in formalin
  • GenBank Accession Number »   OR524520
  • Curated by »   Maybelle Fortaleza
  • Last Updated »   Sept. 13, 2024, 1:46 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    TGCACCCTTTATCTCTTATTTGGTGCTTGGGCCGGTATAGTAGGGACCGCACTAAGTCTGCTAATTCGAGCTGAACTTAGTCAACCAGGAGCCCTTCTAGGTGACGACCAAATTTACAATGTTATTGTTACGGCTCACGCTTTTGTAATAATTTTCTTTATAGTAATGCCTATTATGATCGGCGGGTTCGGAAATTGATTAGTTCCGTTAATGATTGGAGCCCCTGACATGGCATTCCCCCGAATAAATAATATAAGCTTCTGACTTCTCCCCCCTTCTTTCCTTTTACTTCTTGCCTCATCTGGCATTGAAGCAGGGGCAGGAACAGGTTGAACAGTCTATCCCCCTCTTGCAGGCAACCTAGCACATGCAGGAGCCTCTGTTGATTTAACTATTTTTTCTCTTCACCTGGCCGGTATTTCTTCAATTTTAGGGGCTATTAACTTTATTACTACTATTTTAAATATGAAACCTCCAGCTATTTCCCAATACCAGACACCTCTATTCGTTTGAGCAGTTCTCATTACAGCAGTACTTCTACTTCTTTCTCTCCCCGTTTTAGCGGCCGGTATTACAATGCTTTTAACTGATCGAAACTTAAACACAACTTTCTTTGACCCTGCAGGCGGGGGAGACCCTATTCTTTATCAACATCTTTTCTGA