Nemipterus bathybius | University of the Philippines Mindanao FishDive Project | Marine Biodiversity Database Project
Nemipterus bathybius (Snyder, 1911)
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Osteichthyes
  • Order » Acanthuriformes
  • Family » Nemipteridae
  • Genus » Nemipterus
  • Species » bathybius
  • Nemipterus bathybius (Snyder, 1911)
    (Yellowbelly threadfin bream)
  • Description »  

    Marine; demersal; depth range 35 - 300 m . Tropical; 34°N - 23°S, 90°E - 141°E

    Maturity: Lm 11.9  range ? - ? cm Max length : 24.0 cm SL male/unsexed; ; common length : 16.0 cm SL male/unsexed; ; max. reported age: 10 years

    Dorsal spines (total): 10; Dorsal soft rays (total): 9; Anal spines: 3; Anal soft rays: 7. Suborbital spine absent. Preopercle with 3 transverse scale rows. Pectoral fins long, reaching almost to level of origin of anal fin. Pelvic fins moderately long, reaching beyond anus. A line drawn upwards from the posterior edge of suborbital reaching the dorsal profile in front of origin of dorsal fin. Upper lobe of caudal fin falcate and yellow, usually ribbon-like in adults. Axillary scale present. Color: Upper body pinkish, silvery below. Body shape (shape guide): fusiform / normal;  Cross section: oval.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [Governor Generoso, Davao Oriental] [Toril, Davao City, Davao del Sur] [Mati City, Davao Oriental]
  • Collectors/Field Observers »   MA Fortaleza, JJ Lanutan, MC Jandoc, JA Oño
  • Species ID by »   Maybelle A. Fortaleza
  • Institution/Project »   University of the Philippines Mindanao FishDive Project
  • Collection Code »   [None] [MIN_1912_TORL_015A] [FDP_MATI_2202_009A]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:14 July 2020 (FishBase)
  • Sample Availability and Preservation »   Tissue preserved in 95% ETOH; whole fish specimen fixed in formalin
  • GenBank Accession Number »   OR524517
  • Curated by »   Maybelle Fortaleza
  • Last Updated »   Nov. 28, 2024, 12:51 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    TGCACCCTTTATCTCTTATTTGGTGCTTGAGCCGGCATAGTAGGAACCGCACTAAGTCTGCTTATTCGAGCTGAACTCAGTCAACCAGGAGCCCTTTTAGGTGACGACCAAATTTATAATGTCATTGTTACGGCTCACGCTTTTGTAATAATTTTCTTTATAGTAATACCAATTATGATCGGCGGGTTCGGAAACTGATTAATCCCGCTAATGATCGGGGCCCCTGATATGGCCTTCCCTCGAATAAATAATATGAGCTTCTGGCTTTTACCCCCTTCTTTCCTTTTACTTCTCGCCTCATCTGGCATTGAAGCAGGGGCAGGAACAGGTTGAACAGTCTATCCCCCTCTAGCAGGTAACCTGGCACATGCAGGGGCATCTGTTGATTTAACTATTTTCTCCCTTCACCTGGCTGGGATTTCTTCAATTTTAGGGGCCATCAACTTTATCACTACTATTTTTAATATGAAACCTCCAGCTATCTCTCAGTACCAAACACCCCTATTCGTTTGAGCAGTTCTTATTACAGCTGTCCTTCTCCTTCTTTCTCTCCCCGTTTTAGCGGCCGGTATTACAATGCTTTTAACTGACCGTAATCTAAACACAACTTTCTTTGATCCTGCAGGCGGGGGAGATCCTATTCTTTACCAACATCTTTTCTGA