Scarus ghobban | University of the Philippines Mindanao | Marine Biodiversity Database Project
Scarus ghobban
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Labriformes
  • Family » Scaridae
  • Genus » Scarus
  • Species » ghobban
  • Scarus ghobban
    (Blue-barred parrotfish)
  • Description »  

    Marine; brackish; reef-associated; depth range 1 - 90 m . Tropical; 31°N - 35°S, 21°E - 77°W

    Maturity: Lm ?, range 49 - ? cm Max length : 75.0 cm TL male/unsexed; ; common length : 30.0 cm TL male/unsexed; ; max. reported age: 13 years

    Dorsal spines (total): 9; Dorsal soft rays (total): 10; Anal spines: 3; Anal soft rays: 9. This species is distinguished by the following characters: median predorsal scales 6-8 (usually 7); 3 scale rows on cheek, 1(6-7), 2(6-9), 3(3-5); pectoral-fin rays 13-15 (occasionally 15); terminal male usually with 2 conical teeth on side of upper dental plate (female without), with lips mainly covering the plates; caudal fin rounded in small female, with prolonged lobes in large adult. Colour of male dark reddish brown anteriorly with a bright green dot at top end of line from mouth through eye to top of opercular opening; female red on head, belly and fins, side with wavy black and white stripes, and dark green bands around the mouth and eye ( Ref. 9793, 90102). Body shape (shape guide): fusiform / normal;  Cross section: compressed.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [Sasa, Davao City, Davao Del Sur]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   [FDP_IGCS_2202_011A]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:18 September 2009 (FishBase)
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524640
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Nov. 28, 2024, 12:47 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GATATCGGCACCCTTTACCTTGTATTTGGTGCCTGAGCCGGAATAGTAGGCACTGCCTTAAGCCTCCTCATCCGAGCTGAACTAAGTCAACCCGGGGCCCTTCTCGGAGACGACCAGATTTATAATGTTATCGTTACAGCTCATGCATTTGTAATGATCTTTTTTATAGTCATGCCTATCATGATTGGAGGCTTCGGGAACTGACTCATCCCACTCATGATTGGAGCACCTGACATAGCCTTCCCTCGAATGAACAATATGAGCTTCTGACTCCTTCCTCCTTCCTTCCTCCTATTGCTCGCCTCCTCTGGCGTAGAAGCAGGAGCAGGTACCGGATGGACCGTTTACCCCCCTCTAGCAGGGAATCTTGCACACGCAGGGGCATCCGTTGACCTAACAATTTTCTCTCTTCACCTAGCAGGGATTTCATCTATTCTAGGCGCAATCAACTTTATCACAACCATCATTAACATGAAACCGCCTGCCATCTCCCAATACCAAACGCCCCTATTCGTATGAGCTGTTTTAATTACTGCCGTGCTTCTTCTCCTCTCGCTCCCTGTCCTTGCTGCAGGAATCACAATGCTTCTCACAGATCGAAATCTAAACACTACCTTCTTTGACCCTGCAGGCGGAGGAGACCCGATTCTCTATCAACACCTCTTCTGATTCTTC