Epibulus brevis | University of the Philippines Mindanao | Marine Biodiversity Database Project
Epibulus brevis
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Labriformes
  • Family » Labridae
  • Genus » Epibulus
  • Species » brevis
  • Epibulus brevis
    (Latent slingjaw wrasse)
  • Description »  

    Marine; reef-associated; depth range 3 - 18 m . Tropical

    Maturity: Lm ?  range ? - ? cm Max length : 18.5 cm SL male/unsexed; ; 13.5 cm SL (female)

    Dorsal spines (total): 9; Dorsal soft rays (total): 10; Anal spines: 3; Anal soft rays: 8. This species is distinguished from its only congener Epibulus insidiator by the relatively drab coloration of the male; a prominent black pigment on the pectoral fins of most females (vs. absent); smaller size with slightly longer pectoral fins, 23.1-26.2% SL (vs. 20.5-23.3% SL); genetically as determined by mitochondrial DNA analysis; jaw structure very long, its posterior end nearly reaching origin of pelvic fins, and it is extremely protrusible; D IX, 10; A III, 9; pectoral rays 12; lateral line interrupted, 14-15 + 7-9 scales; gill rakers 16-19 (modally 17); females varying from dark to light brown, gray, yellow, to nearly white, with narrow black bar on scales of body except ventrally and posteriorly; males dark brown to gray or dark greenish on body, the head at least partly green with no black stripe through eye; yellow band in lobes of caudal fin; no black on pectoral fins . Cross section: compressed.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [Sasa, Davao City, Davao Del Sur] [Sasa, Davao City, Davao Del Sur] [Sasa, Davao City, Davao del Sur]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   [FDP_IGCS_2201_016B] [FDP_IGCS_2201_016C] [FDP_IGCS_2202_019A]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:12 June 2008 (FishBase)
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524374
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Nov. 28, 2024, 12:55 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GATATCGGCACCCTCTACCTTGTATTTGGTGCCTGGGCCGGAATAGTGGGCACTGCTCTGAGCCTGCTCATTCGGGCAGAGCTCAGCCAGCCGGGCGCTCTTCTTGGGGATGACCAGATCTACAACGTCATCGTCACGGCTCATGCCTTCGTTATAATCTTCTTTATAGTAATACCAATTATGATTGGTGGTTTCGGAAACTGACTCATCCCGCTTATGATCGGAGCCCCAGACATGGCCTTCCCTCGTATAAATAACATAAGCTTCTGACTCCTTCCTCCCTCCTTCCTTCTTCTCCTTGCCTCTTCTGGAGTAGAAGCAGGAGCCGGAACCGGGTGGACAGTCTACCCCCCGCTGGCTGGTAACCTAGCCCACGCAGGCGCGTCCGTAGATCTGACTATCTTCTCCCTCCACTTGGCCGGAATTTCATCCATTCTTGGTGCAATTAATTTTATTACAACTATTATTAATATAAAACCTCCAGCCATTACTCAATACCAGACACCTTTATTTGTCTGGGCCGTCTTAATTACAGCAGTCCTACTTCTCCTGTCACTTCCCGTCCTTGCCGCTGGCATTACAATGCTTCTAACAGACCGAAATCTAAATACCACATTCTTTGACCCAGCGGGAGGAGGGGACCCGATCCTCTACCAACACTTATTCTGATTCTTC