Cheilinus fasciatus | University of the Philippines Mindanao | Marine Biodiversity Database Project
Cheilinus fasciatus
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Labriformes
  • Family » Labridae
  • Genus » Cheilinus
  • Species » fasciatus
  • Cheilinus fasciatus
    (Redbreasted wrasse)
  • Description »  

    Marine; reef-associated; depth range 4 - 80 m , usually 4 - 40 m . Tropical; 23°C - 27°C ; 32°N - 36°S, 24°E - 170°W

    Maturity: Lm ?  range ? - ? cm Max length : 40.0 cm SL male/unsexed; ; max. published weight: 172.83 g

    Dorsal spines (total): 9; Dorsal soft rays (total): 10; Anal spines: 3; Anal soft rays: 8. This species is distinguished by the following characters: body moderately deep, its depth 2.35 to 2.6 times in standard length; dorsal profile of head convex; anterior tip of snout forming an acute angle; jaws prominent, especially lower jaw in large individuals; strong canines 2, situated anteriorly in each jaw; no enlarged tooth present on rear of upper jaw; D IX,10, continuous with spines and anterior soft rays of similar length; A III, 8; pectoral fins with ii unbranched and 10 branched rays; pelvic fins short, not reaching anus; caudal fin rounded in juveniles, the upper and lower rays forming elongate lobes in large individuals, giving the fin a trilobed appearance. Lateral line interrupted below posterior portion of dorsal-fin base, with a total of 22-23 pored scales; scales reaching well onto bases of dorsal and anal fins; scales in front of dorsal fin extending forward to above anterior portion of eye; cheek and opercle scaly; lower jaw without scales . Colour of juveniles brown with 5 white bars across body, the first broadest and brightest, below third dorsal-fin spine, the second bar indistinct, on ventral half of body and the fifth is faint, anteriorly on caudal peduncle; all bars but the second extend onto dorsal and anal fins; 3 faint, short, greenish bars on nape and interorbital space; short, oblique, white or yellowish band from eye across preopercle; narrow white bar at base of caudal fin; large, dark blue spot, surrounded dorsally with orange, anteriorly in dorsal fin. Colour of subadults and females with similar white bars on nape and body as juveniles, but the second bar on lower body becoming more distinct and nearly reaching dorsal fin; there are few scales behind eyes and many scales on body with vertical indistinct dark streak; an orange area from behind eye and nape to pectoral-fin base; humeral area with 2 (sometimes a third above) double, rounded to nearly quadrangular, dark blue or black spots; head becoming olive with short orange-red lines radiating from eye; the lower body, dorsal and anal fins, and posterior half of caudal fin with small dark orange to red spots, only a few spots in fins in some individuals, sometimes median fins also with short red lines, similar to those radiating from eye; caudal fin is white with black bar in centre (bar not reaching upper and lower margins) and black posterior margin. Colour of males with similar color pattern but the suffusion of orange becoming bright orange-red, covering postorbital part of head, anterior of body (including anterior abdomen and chest), and pectoral-fin base, the area restricted posteriorly to the first white bar, not enclosing it; a second white bar across the body reaching dorsal fin; black streak on scales becoming broader and well-defined . Body shape (shape guide): fusiform / normal;  Cross section: oval.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [Sasa, Davao City, Davao Del Sur]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   [FDP_IGCS_2201_015A]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:12 July 2008 (FishBase)
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524326
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Nov. 20, 2024, 9:41 a.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GATATCGGCACCCTCTACCTTGTATTTGGTGCCTGAGCCGGAATGGTGGGCACTGCTTTGAGCCTGCTCATTCGAGCAGAACTCAGCCAGCCAGGCGCTCTTCTTGGGGATGACCAGATCTACAACGTCATCGTCACGGCCCACGCTTTCGTTATGATTTTCTTTATAGTAATACCAATTATGATTGGTGGCTTCGGAAACTGGCTAATCCCCCTTATGATTGGTGCCCCCGACATAGCCTTTCCTCGTATAAACAACATAAGCTTCTGACTTCTCCCTCCCTCCTTCCTACTTCTCCTTGCTTCTTCCGGGGTTGAAGCAGGGGCCGGCACCGGATGGACAGTCTACCCCCCGCTGGCTGGAAACTTAGCCCATGCAGGTGCATCTGTAGATTTAACAATCTTTTCCCTTCATCTGGCCGGAATTTCCTCTATTTTAGGGGCAATTAATTTTATTACAACTATCATTAATATGAAACCCCCCGCTATCACCCAATATCAGACACCCCTGTTCGTATGAGCGGTTCTGATTACAGCAGTTCTACTTCTTCTCTCCCTCCCCGTTCTCGCCGCCGGCATTACAATGCTTCTAACAGATCGAAACCTAAACACCACTTTCTTTGACCCGGCAGGCGGAGGAGACCCAATCCTCTACCAACACCTGTTCTGATTCTTC