Caesio caerulaurea | University of the Philippines Mindanao FishDive Project | Marine Biodiversity Database Project
Caesio caerulaurea (Lacepède, 1801)
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Osteichthyes
  • Order » Perciformes
  • Family » Caesionidae
  • Genus » Caesio
  • Species » caerulaurea
  • Caesio caerulaurea (Lacepède, 1801)
    (Blue and gold fusilier)
  • Description »  

    Marine; reef-associated; non-migratory; depth range 1 - 60 m . Tropical; 34°N - 31°S, 30°E - 116°W

    Maturity: Lm ?  range ? - ? cm Max length : 45.4 cm FL male/unsexed; ; common length : 25.0 cm TL male/unsexed; ; max. published weight: 1.6 kg

    Dorsal spines (total): 10; Dorsal soft rays (total): 14 - 16; Anal spines: 3; Anal soft rays: 10 - 12. This species is distinguished by the following characters: postmaxillary process single; A III,12 (rarely 13); lateral line scales 57-65 (usually around 61); scale rows on spinous part of dorsal fin horizontal; supratemporal bands of scales often interrupted at dorsal midline by a scaleless zone, always a V-shaped scaleless zone anteriorly at midline intruding between the supratemporal band of scales; body colour with upper body bluish and the lower white to pale bluish; a single yellow or golden stripe directly above lateral line except on caudal peduncle where it is about 1 scale above lateral line, the yellow stripe 2 or 3 scales wide, bordered directly above and below by a white or light blue stripe which is about 1 scale wide, caudal-fin lobes with a black median streak .

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [Governor Generoso, Davao Oriental] [Santa Cruz, Davao del Sur]
  • Collectors/Field Observers »   MA Fortaleza, JJ Lanutan, MC Jandoc, JA Oño
  • Species ID by »   Maybelle A. Fortaleza
  • Institution/Project »   University of the Philippines Mindanao FishDive Project
  • Collection Code »   [None] [MIN_1908_STAC_018A]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:04 February 2009 (FishBase)
  • Sample Availability and Preservation »   Tissue preserved in 95% ETOH; whole fish specimen fixed in formalin
  • GenBank Accession Number »   OR524269
  • Curated by »   Maybelle Fortaleza
  • Last Updated »   Sept. 15, 2024, 4:02 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    TGCACCCTTTATCTAGTATTTGGTGCTTGAGCTGGAATGGTAGGCACTGCATTAAGCCTACTCATTCGAGCGGAACTCAGCCAACCAGGAGCTCTTCTTGGAGACGACCAAATTTACAATGTAATTGTTACAGCACATGCGTTTGTAATAATTTTCTTTATAGTAATGCCAATTATGATCGGAGGATTCGGGAACTGACTGATCCCGCTAATGATCGGAGCTCCCGATATAGCATTTCCCCGAATAAATAACATGAGCTTTTGACTCCTCCCCCCATCATTCCTTCTCCTGCTTGCCTCCTCTGGAGTAGAGGCCGGGGCCGGAACTGGGTGGACAGTATATCCCCCACTAGCAGGAAACCTAGCACACGCAGGAGCGTCTGTTGACCTAACCATCTTCTCCCTCCACTTAGCAGGTGTTTCCTCAATTCTAGGGGCTATTAACTTTATCACAACTATTATCAATATGAAACCCCCTGCAATTTCCCAATATCAGACACCCCTGTTTGTTTGAGCCGTCCTCATTACTGCTGTTCTGCTCCTTCTTTCCCTCCCAGTTCTAGCAGCCGGAATTACAATGCTTCTTACAGACCGAAACCTAAACACCACCTTCTTCGACCCAGCGGGAGGAGGAGACCCCATCCTCTACCAACACCTCTTCTGA