Tylosurus crocodilus | University of the Philippines Mindanao FishDive Project | Marine Biodiversity Database Project
Tylosurus crocodilus (Péron and Lesueur, 1821)
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Osteichthyes
  • Order » Beloniformes
  • Family » Belonidae
  • Genus » Tylosurus
  • Species » crocodilus
  • Tylosurus crocodilus (Péron and Lesueur, 1821)
    (Hound needlefish)
  • Description »  

    Marine; reef-associated; oceanodromous ; depth range 0 - 13 m . Tropical; 26°C - 29°C ; 21°N - 1°N

    Maturity: Lm 51.7, range 50 - 55 cm Max length : 150 cm TL male/unsexed; ; common length : 90.0 cm SL male/unsexed; ; max. published weight: 6.4 kg

    Dorsal spines (total): 0; Dorsal soft rays (total): 21 - 24; Anal spines: 0; Anal soft rays: 19 - 22; Vertebrae: 75 - 80. This species with is distinguished by the following characters: body elongate, circular in cross-section; D 21-24 with anterior rays forming a relatively high lobe, 5.4-10.6 body length (excluding the head and caudal fin); dorsal fin origin about equal with or slightly in front to anal fin origin; A 19-22 with anterior rays forming a relatively high lobe, in 5.5-8.0 in BL; pectoral-fin rays 13 to 15 (usually 14 or 15); 270-340 predorsal scales; 75-80 vertebrae; jaws extremely long, forming a stout beak armed with very sharp teeth; no gill rakers absent; caudal fin deeply emarginate, the lower lobe much longer than the upper one and the caudal peduncle with a distinct, black lateral keel; body colour dark bluish green above, silvery below; juveniles (to 20 cm body length) with elevated black lobe in posterior part of dorsal fin which is lost with growth; scales and bones green ( Ref. 9682, 90102).
    Body shape (shape guide): elongated;  Cross section: circular.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [Governor Generoso, Davao Oriental] [Santa Maria, Davao Occidental,]
  • Collectors/Field Observers »   MA Fortaleza, JJ Lanutan, JA Oño
  • Species ID by »   Maybelle A. Fortaleza
  • Institution/Project »   University of the Philippines Mindanao FishDive Project
  • Collection Code »   [FDP_GOVG_2209_010A] [MIN_1910_STAM_039A]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:21 August 2012 (FishBase)
  • Sample Availability and Preservation »   Tissue preserved in 95% ETOH; whole fish specimen fixed in formalin
  • GenBank Accession Number »   OR524706
  • Curated by »   Maybelle Fortaleza
  • Last Updated »   Sept. 15, 2024, 8:22 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GGCACCCTTTATCTGGTATTCGGTGCTTGAGCTGGAATAGTAGGCACTGCCTTAAGCCTCCTTATTCGAGCAGAACTGAGCCAACCTGGCTCCCTTTTAGGCGATGACCAAATTTATAATGTTATCGTTACAGCACATGCATTTGTAATGATTTTCTTTATAGTAATACCAATTATGATTGGAGGCTTTGGAAACTGATTAATTCCACTTATGATTGGAGCTCCTGACATAGCATTCCCCCGAATAAATAACATAAGCTTTTGACTCCTACCTCCATCATTTCTTCTCCTTTTAGCCTCATCTGGGGTTGAAGCAGGTGCAGGAACTGGATGAACTGTTTATCCCCCTCTAGCCGGGAACCTAGCCCATGCTGGAGCATCTGTAGATTTAACAATTTTCTCTTTACATTTAGCAGGTGTTTCATCAATTCTTGGTGCCATTAATTTTATTACAACAATTATTAATATGAAACCCCCTGCAATCTCACAATACCAGACCCCCCTCTTTGTATGGGCTGTCCTGATTACTGCTGTTCTTCTCCTTCTCTCCCTGCCTGTATTAGCTGCTGGCATTACTATACTTCTAACAGACCGGAATTTGAACACCACCTTCTTCGATCCTGCCGGAGGCGGAGATCCTATCCTCTACCAACACCTTTTCTGA