Acanthurus mata | University of the Philippines Mindanao FishDive Project | Marine Biodiversity Database Project
Acanthurus mata (Cuvier, 1829)
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Osteichthyes
  • Order » Acanthuriformes
  • Family » Acanthuridae
  • Genus » Acanthurus
  • Species » mata
  • Acanthurus mata (Cuvier, 1829)
    (Elongate surgeonfish)
  • Description »  

    Marine; reef-associated; depth range 5 - 100 m , usually 5 - 45 m . Tropical; 23°C - 28°C ; 35°N - 35°S, 30°E - 137°W

    Maturity: Lm ?  range ? - ? cm Max length : 50.0 cm TL male/unsexed; ; max. reported age: 23 years

    Dorsal spines (total): 9; Dorsal soft rays (total): 24 - 26; Anal spines: 3; Anal soft rays: 23 - 24. This species is distinguished by the following characters: body moderately deep and compressed, its depth 2.1-2.5 times in standard length or SL (smaller individuals are deeper-bodied); snout relatively short, 6-6.9 times in SL; eye 3.2-4.5 times in head length (at 12-28 cm SL); mouth small; teeth spatulate, close-set, with denticulate edges, and small for the genus; total gill rakers on first gill arch 13-15; continuous, unnotched dorsal fin IX,24-26; A III,23-24; caudal fin emarginate to lunate, concavity 6.5-9 times in SL (concavity is greater in larger individuals); caudal peduncle narrow, the least depth 10-12 times in SL with a lancet-like spine on each side which folds into a deep horizontal groove; stomach large, U-shaped, thin-walled with large, thorn-like papillae on inner surface; colour brown with longitudinal blue lines on head and body; a yellow area behind eye and 2 yellow bands extending anteriorly from eye; when alive, this fish is capable of changing its ground colour from dark brown to pale blue . Body shape (shape guide): short and / or deep;  Cross section: compressed.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [Santa Cruz, Davao del Sur] [Santa Cruz, Davao del Sur]
  • Collectors/Field Observers »   MA Fortaleza, JJ Lanutan, JA Oño
  • Species ID by »   Maybelle A. Fortaleza
  • Institution/Project »   University of the Philippines Mindanao FishDive Project
  • Collection Code »   [None] [FDP_STAC_2209_004A]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:04 May 2010 (FishBase)
  • Sample Availability and Preservation »   Tissue preserved in 95% ETOH; whole fish specimen fixed in formalin
  • GenBank Accession Number »   OR524234
  • Curated by »   Maybelle Fortaleza
  • Last Updated »   Nov. 28, 2024, 1:12 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GGCACCCTTTATCTAGTATTCGGTGCTTGAGCTGGGATAGTAGGAACGGCTCTAAGCCTCCTAATCCGAGCAGAATTAAGCCAACCAGGCGCCCTCCTAGGGGATGACCAGATTTATAATGTAATTGTTACAGCACATGCATTCGTAATAATTTTCTTTATAGTAATACCAATCATGATTGGTGGGTTTGGAAACTGATTAATTCCACTAATGATCGGAGCTCCTGATATAGCATTCCCACGAATGAACAATATGAGCTTTTGACTACTACCGCCATCTTTCCTATTATTACTTGCATCCTCCGCAGTAGAATCCGGCGCCGGTACGGGATGAACAGTTTATCCTCCTCTAGCCGGTAACCTTGCACATGCAGGAGCATCCGTAGACTTGACTATTTTCTCCCTTCACCTCGCAGGAATTTCCTCAATTCTTGGGGCTATTAACTTTATTACAACAATCATTAATATAAAACCCCCTGCTACTTCTCAATATCAAACCCCTTTATTTGTATGAGCAGTATTAATTACTGCCGTTCTACTACTCCTTTCACTTCCCGTTCTTGCTGCTGGAATTACAATACTACTCACAGACCGAAACCTAAATACCACCTTCTTTGACCCGGCAGGCGGAGGAGATCCTATTCTATATCAACATTTATTCTGA