Acanthurus mata | University of the Philippines Mindanao FishDive Project | Marine Biodiversity Database Project
Acanthurus mata (Cuvier, 1829)
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Osteichthyes
  • Order » Acanthuriformes
  • Family » Acanthuridae
  • Genus » Acanthurus
  • Species » mata
  • Acanthurus mata (Cuvier, 1829)
    (Elongate surgeonfish)
  • Description »   (Wikipedia) Acanthurus mata, the pale surgeonfish, blue-lined surgeonfish, mata surgeonfish, striped surgeonfish, tailring surgeon, white-tail lancet or yellowmask surgeonfish, is a species of marine ray-finned fish belonging to the family Acanthuridae, the surgeonfishes, unicornfishes and tangs. This species is found in the Indo-Pacific region.
    Full article at Wikipedia
  • Local Name »  
  • Locality/Distribution »   [Santa Cruz, Davao del Sur] [Santa Cruz, Davao del Sur]
  • Collectors/Field Observers »   MA Fortaleza, JJ Lanutan, JA Oño
  • Species ID by »   Maybelle A. Fortaleza
  • Institution/Project »   University of the Philippines Mindanao FishDive Project
  • Collection Code »   FDP_STAC_2209_004_A
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:04 May 2010 (FishBase)
  • Sample Availability and Preservation »   Tissue preserved in 95% ETOH; whole fish specimen fixed in formalin
  • GenBank Accession Number »   OR524234
  • Curated by »   Maybelle Fortaleza
  • Last Updated »   Sept. 15, 2024, 9:37 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GGCACCCTTTATCTAGTATTCGGTGCTTGAGCTGGGATAGTAGGAACGGCTCTAAGCCTCCTAATCCGAGCAGAATTAAGCCAACCAGGCGCCCTCCTAGGGGATGACCAGATTTATAATGTAATTGTTACAGCACATGCATTCGTAATAATTTTCTTTATAGTAATACCAATCATGATTGGTGGGTTTGGAAACTGATTAATTCCACTAATGATCGGAGCTCCTGATATAGCATTCCCACGAATGAACAATATGAGCTTTTGACTACTACCGCCATCTTTCCTATTATTACTTGCATCCTCCGCAGTAGAATCCGGCGCCGGTACGGGATGAACAGTTTATCCTCCTCTAGCCGGTAACCTTGCACATGCAGGAGCATCCGTAGACTTGACTATTTTCTCCCTTCACCTCGCAGGAATTTCCTCAATTCTTGGGGCTATTAACTTTATTACAACAATCATTAATATAAAACCCCCTGCTACTTCTCAATATCAAACCCCTTTATTTGTATGAGCAGTATTAATTACTGCCGTTCTACTACTCCTTTCACTTCCCGTTCTTGCTGCTGGAATTACAATACTACTCACAGACCGAAACCTAAATACCACCTTCTTTGACCCGGCAGGCGGAGGAGATCCTATTCTATATCAACATTTATTCTGA