Ctenochaetus striatus | University of the Philippines Mindanao FishDive Project | Marine Biodiversity Database Project
Ctenochaetus striatus (Quoy and Gaimard, 1825)
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Osteichthyes
  • Order » Acanthuriformes
  • Family » Acanthuridae
  • Genus » Ctenochaetus
  • Species » striatus
  • Ctenochaetus striatus (Quoy and Gaimard, 1825)
    (Striated surgeonfish)
  • Description »  

    Marine; reef-associated; depth range 0 - 60 m , usually 6 - 30 m . Tropical; 24°C - 28°C ; 35°N - 34°S, 99°E - 77°W

    Maturity: Lm ?, range 10 - ? cm Max length : 26.0 cm TL male/unsexed; ; common length : 18.0 cm TL male/unsexed; ; max. published weight: 437.00 g ; max. reported age: 36 years

    Dorsal spines (total): 8; Dorsal soft rays (total): 27 - 31; Anal spines: 3; Anal soft rays: 24 - 28. This species is distinguished by the following characters: body deep and compressed, its depth 1.9-2.3 times in standard length or SL; mouth small, teeth numerous (> 30 in jaws of adults), movable, slender and elongate, with expanded incurved tips which are denticulate on the lateral margin (6 denticulations on upper and 4 on lower teeth); total gill rakers on first gill arch 27-36; a continuous unnotched dorsal fin with VIII,27-31; AIII,24-28; caudal fin lunate, concavity 3.7-6 times in SL; a lancet-like spine on caudal peduncle which folds into a deep horizontal groove; colour dark olive to yellowish brown with blue or blue-grey lengthwise lines on body and small orange spots on head and nape; dorsal and anal fins with about 5 lengthwise dark bluish bands; pectoral fins pale with brownish yellow rays; a small blackish spot at rear base of dorsal fin of juveniles and small adults . Body shape (shape guide): short and / or deep;  Cross section: compressed.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [Samal Island, Davao del Norte] [Santa Cruz, Davao del Sur]
  • Collectors/Field Observers »   CL Nañola, MA Fortaleza, KL Labrador, JJ Lanutan
  • Species ID by »   Maybelle A. Fortaleza
  • Institution/Project »   University of the Philippines Mindanao FishDive Project
  • Collection Code »   [FDP_IGCS_2201_005A] [MIN_1811_STAC_059A]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:07 May 2010 (FishBase)
  • Sample Availability and Preservation »   Tissue preserved in 95% ETOH; whole fish specimen fixed in formalin
  • GenBank Accession Number »   OR524353
  • Curated by »   Maybelle Fortaleza
  • Last Updated »   Nov. 28, 2024, 12:34 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GGCACCCTTTATTTAGTATTTGGTGCTTGAGCTGGGATAGTGGGAACGGCTCTAAGCCTCCTAATCCGAGCAGAATTAAGCCAACCAGGCGCCCTCCTAGGGGATGACCAGATTTATAACGTTATTGTTACAGCACATGCGTTCGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGTGGATTTGGAAACTGATTAATTCCACTAATGATTGGAGCCCCTGATATAGCATTCCCACGAATGAATAACATGAGCTTCTGACTTCTGCCCCCATCTTTCCTGCTTTTACTTGCATCTTCTGCAGTAGAATCTGGTGCTGGAACAGGATGGACAGTTTATCCCCCTCTAGCCGGTAATCTAGCACATGCGGGGGCATCTGTAGACCTCACTATTTTCTCCCTACATCTCGCAGGGATTTCCTCAATTCTTGGGGCTATCAACTTTATTACAACAATTATTAACATGAAACCCCCAGCCATCTCCCAATACCAGACACCTCTATTCGTATGAGCTGTGCTAATTACCGCCGTTCTACTCCTTCTCTCACTTCCTGTCCTTGCTGCCGGAATTACAATGCTACTTACAGATCGCAACCTAAACACCACCTTCTTCGACCCTGCAGGCGGAGGGGACCCTATCCTGTATCAGCACCTGTTCTGA