Leptoscarus vaigiensis | University of the Philippines Mindanao | Marine Biodiversity Database Project
Leptoscarus vaigiensis
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Labriformes
  • Family » Scaridae
  • Genus » Leptoscarus
  • Species » vaigiensis
  • Leptoscarus vaigiensis
    (Marbled parrotfish)
  • Description »   (Wikipedia) The marbled parrotfish (Leptoscarus vaigiensis), also known as the seagrass parrotfish, is a species of parrotfish, the only known member of the genus Leptoscarus. It has a wide Indo-Pacific distribution and is also found in the southeastern Atlantic Ocean. It is a coastal species found in beds of sea grass and seaweed.
    Full article at Wikipedia
  • Local Name »  
  • Locality/Distribution »   [Samal Island, Davao del Norte]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   FDP_IGCS_2202_031A
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524437
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Nov. 11, 2024, 11 a.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GACATTGGCACCCTCTACCTTGTATTTGGTGCCTGAGCCGGAATAGTGGGCACTGCCTTGAGCCTTCTAATTCGAGCCGAACTAAACCAGCCCGGCGCTCTCCTAGGAGACGACCAAATCTACAACGTAATTGTTACGGCCCACGCGTTCGTAATAATCTTTTTTATAGTCATGCCGATTATGATCGGGGGGTTTGGAAACTGACTAATCCCTTTAATGATTGGCGCCCCTGACATGGCTTTCCCCCGAATAAATAACATGAGCTTCTGACTTCTCCCTCCTTCTTTCCTTCTTCTACTTGCCTCTTCTGGTGTAGAAGCCGGGGCAGGGACTGGGTGAACCGTGTACCCCCCTCTAGCAGGGAATCTAGCACATGCCGGGGCTTCCGTAGATCTCACAATTTTCTCCCTCCACCTAGCAGGGATCTCGTCTATTCTCGGAGCCATCAACTTCATTACAACCATCATCAACATGAAACCCCCTGCCATTTCACAGTATCAAACCCCCCTATTCGTGTGAGCTGTTTTGATTACTGCGGTTCTTCTTCTCTTATCCCTCCCTGTTCTCGCTGCAGGAATTACAATACTGCTTACCGACCGAAACTTAAACACTACATTCTTCGACCCCGCAGGAGGAGGAGACCCCATCCTCTACCAACACTTATTCTGATTCTTT