Leptoscarus vaigiensis | University of the Philippines Mindanao | Marine Biodiversity Database Project
Leptoscarus vaigiensis
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Labriformes
  • Family » Scaridae
  • Genus » Leptoscarus
  • Species » vaigiensis
  • Leptoscarus vaigiensis
    (Marbled parrotfish)
  • Description »  

    Marine; reef-associated; depth range 1 - 15 m . Tropical; 30°N - 36°S, 18°E - 108°W

    Maturity: Lm ?  range ? - ? cm Max length : 35.2 cm TL male/unsexed; ; max. published weight: 657.00 g

    Dorsal spines (total): 9; Dorsal soft rays (total): 10; Anal spines: 3; Anal soft rays: 9; Vertebrae: 25. This species distinguished by the following characters: median predorsal scales 4 (occasionally 3); 1 scale row on cheek, 1(4), below eye; pectoral-fin rays 13; relatively elongate, its depth 2.9-3.8 in SL; unique narrow dental plates composed of numerous small teeth. Colour when fresh, greenish or olive brown, often strongly mottled; male with midlateral white stripe ( Ref. 9793, 90102). Body shape (shape guide): fusiform / normal;  Cross section: compressed.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [Samal Island, Davao del Norte]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   [FDP_IGCS_2202_031A]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:17 September 2009 (FishBase)
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524437
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Nov. 28, 2024, 12:57 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GACATTGGCACCCTCTACCTTGTATTTGGTGCCTGAGCCGGAATAGTGGGCACTGCCTTGAGCCTTCTAATTCGAGCCGAACTAAACCAGCCCGGCGCTCTCCTAGGAGACGACCAAATCTACAACGTAATTGTTACGGCCCACGCGTTCGTAATAATCTTTTTTATAGTCATGCCGATTATGATCGGGGGGTTTGGAAACTGACTAATCCCTTTAATGATTGGCGCCCCTGACATGGCTTTCCCCCGAATAAATAACATGAGCTTCTGACTTCTCCCTCCTTCTTTCCTTCTTCTACTTGCCTCTTCTGGTGTAGAAGCCGGGGCAGGGACTGGGTGAACCGTGTACCCCCCTCTAGCAGGGAATCTAGCACATGCCGGGGCTTCCGTAGATCTCACAATTTTCTCCCTCCACCTAGCAGGGATCTCGTCTATTCTCGGAGCCATCAACTTCATTACAACCATCATCAACATGAAACCCCCTGCCATTTCACAGTATCAAACCCCCCTATTCGTGTGAGCTGTTTTGATTACTGCGGTTCTTCTTCTCTTATCCCTCCCTGTTCTCGCTGCAGGAATTACAATACTGCTTACCGACCGAAACTTAAACACTACATTCTTCGACCCCGCAGGAGGAGGAGACCCCATCCTCTACCAACACTTATTCTGATTCTTT