Oxycheilinus digramma | University of the Philippines Mindanao | Marine Biodiversity Database Project
Oxycheilinus digramma
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Labriformes
  • Family » Labridae
  • Genus » Oxycheilinus
  • Species » digramma
  • Oxycheilinus digramma
    (Cheeklined wrasse)
  • Description »  

    Marine; brackish; reef-associated; depth range 3 - 60 m . Tropical; 30°N - 23°S

    Maturity: Lm ?  range ? - ? cm Max length : 40.0 cm SL male/unsexed;

    Dorsal spines (total): 9; Dorsal soft rays (total): 10; Anal spines: 3; Anal soft rays: 8 - 11. Differs from the very similar C. unifasciatus by always lacking the white bar in front of the caudal base as well as the area clear of red streaks extending from the eye to just above the pectoral axis . Body shape (shape guide): fusiform / normal;  Cross section: compressed.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [Sasa, Davao City, Davao del Sur]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   [FDP_IGCS_2202_038A]
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:25 March 2009 (FishBase)
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524539
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Nov. 28, 2024, 12:59 p.m.
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GATATTGGCACCCTCTACCTTGTTTTTGGTGCCTGAGCTGGGATAGTGGGCACAGCCCTAAGCTTGCTTATTCGAGCAGAACTCAGTCAACCAGGAGCTCTTCTTGGTGACGACCAGATCTATAATGTAATCGTTACCGCCCATGCCTTCGTTATGATTTTCTTTATAGTAATGCCAATCATAATTGGAGGCTTTGGGAACTGACTTATTCCGTTAATGGTAGGAGCCCCCGATATAGCCTTCCCTCGGATAAACAATATGAGTTTCTGACTTCTACCCCCATCTTTCCTTCTCCTACTTGCCTCTTCTGGGGTAGAAGCAGGTGCCGGTACTGGATGAACAGTTTACCCCCCACTAGCGGGGAACTTAGCCCACGCCGGTGCGTCCGTAGACCTTACAATTTTCTCCCTGCACTTAGCAGGGATCTCCTCAATTCTCGGCGCCATCAATTTCATTACTACTATTATCAATATGAAACCCCCCGCCATCACTCAGTACCAGACACCTCTGTTCGTTTGAGCAGTCCTAATTACTGCAGTCCTCCTTCTCCTTTCTCTCCCTGTTTTGGCCGCTGGGATTACAATGCTCTTAACAGACCGCAACCTAAATACTACTTTCTTCGACCCGGCCGGTGGCGGGGACCCAATCCTCTACCAACATCTATTCTGATTCTTC

    • Visit FishBase Website
    Visit BOLD Systems Website
    University of the Philippines Mindanao, Mintal, Tugbok District, Davao City © ABRAHAM Program 2025 - All Rights Reserved. 625 visit(s) today - 599491 total visits (856 average daily visits): 2023-05-22 - 2025-04-21 (700 days)