Oxycheilinus digramma | University of the Philippines Mindanao | Marine Biodiversity Database Project
Oxycheilinus digramma
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Labriformes
  • Family » Labridae
  • Genus » Oxycheilinus
  • Species » digramma
  • Oxycheilinus digramma
    (Cheeklined wrasse)
  • Description »   (Wikipedia) The cheek-lined wrasse, Oxycheilinus digramma, is a species of wrasse native to the Indian Ocean and the western Pacific Ocean. It is of minor importance to local commercial fisheries and can also be found in the aquarium trade. The fish grows to about 40 cm (16 in) in standard length. The side of the fish's head has horizontal stripes, while the front of the head has red spots. Coloring of the fish varies from pale gray to purple. Aquarium specimens are less tense than their wild counterparts.
    Full article at Wikipedia
  • Local Name »  
  • Locality/Distribution »   [Sasa, Davao City, Davao del Sur]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   FDP_IGCS_2202_038A
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524539
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Nov. 11, 2024, 11:03 a.m.
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GATATTGGCACCCTCTACCTTGTTTTTGGTGCCTGAGCTGGGATAGTGGGCACAGCCCTAAGCTTGCTTATTCGAGCAGAACTCAGTCAACCAGGAGCTCTTCTTGGTGACGACCAGATCTATAATGTAATCGTTACCGCCCATGCCTTCGTTATGATTTTCTTTATAGTAATGCCAATCATAATTGGAGGCTTTGGGAACTGACTTATTCCGTTAATGGTAGGAGCCCCCGATATAGCCTTCCCTCGGATAAACAATATGAGTTTCTGACTTCTACCCCCATCTTTCCTTCTCCTACTTGCCTCTTCTGGGGTAGAAGCAGGTGCCGGTACTGGATGAACAGTTTACCCCCCACTAGCGGGGAACTTAGCCCACGCCGGTGCGTCCGTAGACCTTACAATTTTCTCCCTGCACTTAGCAGGGATCTCCTCAATTCTCGGCGCCATCAATTTCATTACTACTATTATCAATATGAAACCCCCCGCCATCACTCAGTACCAGACACCTCTGTTCGTTTGAGCAGTCCTAATTACTGCAGTCCTCCTTCTCCTTTCTCTCCCTGTTTTGGCCGCTGGGATTACAATGCTCTTAACAGACCGCAACCTAAATACTACTTTCTTCGACCCGGCCGGTGGCGGGGACCCAATCCTCTACCAACATCTATTCTGATTCTTC

    • Visit BOLD Systems Website
    University of the Philippines Mindanao, Mintal, Tugbok District, Davao City © ABRAHAM Program 2024 - All Rights Reserved. 239 visit(s) today - 305170 total visits (553 average daily visits): 2023-05-22 - 2024-11-24 (552 days)