Halichoeres melanurus | University of the Philippines Mindanao | Marine Biodiversity Database Project
Halichoeres melanurus
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Labriformes
  • Family » Labridae
  • Genus » Halichoeres
  • Species » melanurus
  • Halichoeres melanurus
    (Tail-spot wrasse)
  • Description »   (Wikipedia) The tail-spot wrasse, Halichoeres melanurus, is a species of wrasse in the western Pacific from Japan to Samoa and Tonga and south to the Great Barrier Reef. This species is found along rocky shores or on coral reefs at depths from 1 to 15 m (3.3 to 49.2 ft). It can reach 12 cm (4.7 in) in total length. This species is popular for display in public aquaria and can be found in the aquarium trade.
    Full article at Wikipedia
  • Local Name »  
  • Locality/Distribution »   [Sasa, Davao City, Davao del Sur]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   FDP_IGCS_2202_039A
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524413
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Nov. 20, 2024, 9:48 a.m.
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GATATCGGCACCCTTTATTTAGTATTCGGGGCCTGAGCCGGAATAGTGGGCACAGCCCTGAGCTTGCTTATTCGAGCTGAGTTAAGCCAGCCCGGCGCCCTCCTCGGGGATGATCAGATTTATAATGTTATCGTCACCGCCCATGCCTTCGTAATAATTTTCTTTATAGTTATACCAATCATGATTGGCGGCTTCGGAAACTGACTTATTCCTCTAATAATCGGGGCCCCTGATATGGCCTTCCCTCGAATAAATAACATGAGCTTTTGACTCCTCCCCCCTTCCTTCCTTCTACTCCTCGCCTCCTCAGGCGTAGAGGCAGGCGCAGGTACTGGCTGAACAGTCTACCCACCCCTGGCAGGCAACTTAGCCCATGCAGGAGCCTCCGTAGACCTTACCATCTTTTCCCTTCACTTAGCCGGAATTTCATCAATCCTCGGGGCTATCAACTTTATTACTACAATTATTAATATGAAACCTCCTGCTATCTCACAATACCAGACCCCTCTCTTTGTTTGAGCCGTTCTAATTACTGCTGTTCTACTCCTTCTTTCTCTTCCTGTGCTAGCTGCTGGCATTACAATGTTACTCACAGATCGAAATTTAAATACCACATTCTTCGACCCCGCAGGAGGGGGAGACCCAATTCTTTACCAACATCTCTTCTGATTCTTC

    • Visit BOLD Systems Website
    University of the Philippines Mindanao, Mintal, Tugbok District, Davao City © ABRAHAM Program 2024 - All Rights Reserved. 320 visit(s) today - 305251 total visits (553 average daily visits): 2023-05-22 - 2024-11-24 (552 days)