Platax pinnatus | University of the Philippines Mindanao | Marine Biodiversity Database Project
Platax pinnatus
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Moroniformes
  • Family » Ephippidae
  • Genus » Platax
  • Species » pinnatus
  • Platax pinnatus
    (Dusky batfish)
  • Description »  

    Marine; reef-associated; depth range 15 - 30 m . Tropical; 30°N - 23°S, 105°E - 171°E

    Maturity: Lm ?  range ? - ? cm Max length : 45.0 cm TL male/unsexed;

    Dorsal spines (total): 5 - 6; Dorsal soft rays (total): 34 - 37; Anal spines: 3; Anal soft rays: 24 - 28. Juveniles are dark brown to black with a brilliant crimson margin around the entire fish . Adults dull silver with short fins . Body orbicular and strongly compressed, its depth more than twice length of head and 0.9 to 1.3 times in SL. Head length 2.9 to 3.8 times in SL. Large adults (above 35 cm SL) with protruding snout, the front head profile distinctly concave. Interorbital width 34 to 42% head length. Jaws with bands of slender, flattened, tricuspid teeth, the middle cusp about twice length of lateral cusps. Vomer with teeth, but none on palatines. Three or 4 pores on each side of lower jaw. Preopercle smooth. Opercle without spines . Body shape (shape guide): short and / or deep;  Cross section: compressed.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [Sasa, Davao City, Davao del Sur]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   [FDP_IGCS_2202_042A]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:15 August 2023 (FishBase)
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524566
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Nov. 28, 2024, 1:04 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GATATCGGCACCCTCTATCTAGTATTTGGTGCTTGAGCCGGTATAGTAGGCACAGCACTAAGCCTGCTCATCCGAGCAGAGCTTAACCAACCCGGCGCCCTCCTTGGGGACGACCAGATTTATAATGTAATTGTTACGGCACATGCGTTCGTAATAATTTTCTTTATAGTTATGCCGGTAATAATCGGAGGCTTTGGAAACTGACTGATCCCCCTAATGATCGGCGCCCCAGACATGGCCTTCCCTCGAATGAACAACATGAGCTTCTGACTTCTTCCCCCCTCATTCCTCCTACTTCTTGCCTCTTCTGGTGTAGAAGCCGGTGCAGGAACAGGGTGAACTGTATACCCCCCACTAGCCAGCAATTTAGCACATGCAGGCGCATCCGTTGACTTAACTATTTTCTCCCTTCACTTAGCAGGTATTTCATCAATTCTAGGAGCCATTAACTTTATTACAACAATCATTAACATGAAACCTCCCGCCATCTCCCAGTATCAAACCCCACTGTTCGTCTGAGCGGTCCTAATTACGGCCGTCCTCCTACTCCTATCCCTCCCCGTTCTTGCTGCCGGCATTACCATGCTGCTCACAGATCGTAACCTGAACACCACTTTCTTCGACCCAGCAGGAGGAGGAGACCCAATTCTTTACCAGCACCTGTTCTGATTCTTC