Plectorhinchus polytaenia | University of the Philippines Mindanao | Marine Biodiversity Database Project
Plectorhinchus polytaenia
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Perciformes
  • Family » Haemulidae
  • Genus » Plectorhinchus
  • Species » polytaenia
  • Plectorhinchus polytaenia
    (Ribboned sweetlips)
  • Description »   (Wikipedia) Plectorhinchus polytaenia, the ribboned sweetlips, also known as Tesone di mare or yellow-ribbon sweetlips, is a species of marine ray-finned fish, a sweetlips belonging to the subfamily Plectorhinchinae, one of two subfamilies in the family Haemulidae, the grunts. It is native to the Indian Ocean and the western Pacific Ocean.
    Full article at Wikipedia
  • Local Name »  
  • Locality/Distribution »   [Sasa, Davao City, Davao del Sur]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   FDP_IGCS_2202_043B
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524571
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Nov. 11, 2024, 11:02 a.m.
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GATATCGGCACCCTCTATCTAGTATTTGGTGCTTGAGCTGGAATAGTGGGGACGGCCTTAAGCTTGCTCATCCGAGCAGAATTAAGCCAACCCGGCGCTCTCCTGGGAGACGACCAGATTTACAATGTAATTGTTACGGCGCATGCGTTCGTAATAATCTTTTTTATGGTTATACCAATCCTAATTGGAGGGTTCGGAAACTGACTAGTCCCACTAATAATTGGGGCACCTGACATAGCATTCCCCCGAATGAACAATATGAGCTTCTGACTTCTCCCACCATCCTTCCTTCTCCTCCTAGCCTCCTCAGGTGTAGAAGCCGGAGCAGGAACTGGTTGAACGGTTTATCCCCCACTAGCCGGTAATTTGGCACACGCAGGAGCATCCGTTGACCTAACAATCTTCTCCCTCCATCTAGCCGGTATTTCCTCAATTCTCGGGGCAATCAATTTTATTACAACAATCATTAACATGAAACCCCCTGCAATTTCGCAATACCAAACCCCTCTATTCGTCTGATCCGTTCTAGTAACCGCTGTTCTCCTTCTCCTCTCCCTTCCAGTGCTTGCTGCTGGGATTACAATGCTCCTCACAGATCGAAACCTTAATACTACTTTCTTTGACCCAGCAGGAGGAGGAGACCCAATTCTCTACCAACACCTATGCTGATTCTTC

    • Visit BOLD Systems Website
    University of the Philippines Mindanao, Mintal, Tugbok District, Davao City © ABRAHAM Program 2024 - All Rights Reserved. 1430 visit(s) today - 304916 total visits (553 average daily visits): 2023-05-22 - 2024-11-23 (551 days)