Plectorhinchus polytaenia | University of the Philippines Mindanao | Marine Biodiversity Database Project
Plectorhinchus polytaenia
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Perciformes
  • Family » Haemulidae
  • Genus » Plectorhinchus
  • Species » polytaenia
  • Plectorhinchus polytaenia
    (Ribboned sweetlips)
  • Description »  

    Marine; reef-associated; depth range 5 - 40 m . Tropical; 22°N - 25°S, 72°E - 153°E

    Maturity: Lm ?  range ? - ? cm Max length : 50.0 cm TL male/unsexed;

    Dorsal spines (total): 12 - 13; Dorsal soft rays (total): 19 - 22; Anal spines: 3; Anal soft rays: 7 - 8. This species is distinguished by the following characters: chin with 6 pores, no median pit; gill rakers on first gill arch 7-9 + 1 + 17-20 = 26-29; Dorsal XII (rarely XIII), 19-22, 3rd-5th spines longest; lips fleshy, moderately swollen with age; scales ctenoid (rough to touch); lateral line tubed scales about 54-60; body depth 2.6-2.9 in SL; caudal fin rounded to slightly emarginate. Colour: brown to yellowish grey with 5 to 9 fairly narrow grey or white longitudinal stripes outlined with dark brown on body and continuing around snout; fins yellow, soft dorsal, caudal, and pectoral fins with darker stripes disappearing with age; eye and lips yellowish; mouth, tongue, and gill rakers scarlet; chin white; juveniles have fins striped and fewer stripes on body ( Ref. 47695, 90102). Body shape (shape guide): fusiform / normal;  Cross section: compressed.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [Sasa, Davao City, Davao del Sur]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   [FDP_IGCS_2202_043B]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:28 June 2018 (FishBase)
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524571
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Nov. 28, 2024, 1:05 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GATATCGGCACCCTCTATCTAGTATTTGGTGCTTGAGCTGGAATAGTGGGGACGGCCTTAAGCTTGCTCATCCGAGCAGAATTAAGCCAACCCGGCGCTCTCCTGGGAGACGACCAGATTTACAATGTAATTGTTACGGCGCATGCGTTCGTAATAATCTTTTTTATGGTTATACCAATCCTAATTGGAGGGTTCGGAAACTGACTAGTCCCACTAATAATTGGGGCACCTGACATAGCATTCCCCCGAATGAACAATATGAGCTTCTGACTTCTCCCACCATCCTTCCTTCTCCTCCTAGCCTCCTCAGGTGTAGAAGCCGGAGCAGGAACTGGTTGAACGGTTTATCCCCCACTAGCCGGTAATTTGGCACACGCAGGAGCATCCGTTGACCTAACAATCTTCTCCCTCCATCTAGCCGGTATTTCCTCAATTCTCGGGGCAATCAATTTTATTACAACAATCATTAACATGAAACCCCCTGCAATTTCGCAATACCAAACCCCTCTATTCGTCTGATCCGTTCTAGTAACCGCTGTTCTCCTTCTCCTCTCCCTTCCAGTGCTTGCTGCTGGGATTACAATGCTCCTCACAGATCGAAACCTTAATACTACTTTCTTTGACCCAGCAGGAGGAGGAGACCCAATTCTCTACCAACACCTATGCTGATTCTTC