Chaetodon baronessa | University of the Philippines Mindanao | Marine Biodiversity Database Project
Chaetodon baronessa
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Perciformes
  • Family » Chaetodontidae
  • Genus » Chaetodon
  • Species » baronessa
  • Chaetodon baronessa
    (Eastern triangular butterflyfish)
  • Description »   (Wikipedia) The eastern triangle butterflyfish (Chaetodon baronessa), also known as the baroness butterflyfish, is a species of marine ray-finned fish, a butterflyfish belonging to the family Chaetodontidae. It is found in the central Indo-West Pacific region from the Cocos-Keeling Islands and Indonesia in the eastern Indian Ocean to Fiji and Tonga, north to southern Japan, south to New Caledonia and New South Wales in Australia.
    Full article at Wikipedia
  • Local Name »  
  • Locality/Distribution »   [Sasa, Davao del Sur, Davao City]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   FDP_IGCS_2202_046C
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524312
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Sept. 15, 2024, 11:38 p.m.
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GATATCGGCACCCTCTATATAGTATTTGGTGCTTGAGCTGGAATAGTGGGCACCGCTTTAAGTCTGCTCATCCGAGCAGAACTTAGCCAACCCGGCACTCTCCTGGGCGATGACCAAATCTATAATGTGATTGTTACAGCACATGCATTTGTAATAATTTTCTTTATAGTTATACCAATCATGATTGGAGGATTCGGAAACTGGCTTATCCCCTTAATAATTGGGGCCCCTGATATGGCCTTCCCCCGAATAAATAATATGAGCTTCTGGCTCCTGCCCCCTTCCTTCTTCCTACTACTCGCCTCTTCTGGCGTAGAGTCCGGGGCTGGTACAGGGTGGACAGTTTATCCCCCGCTAGCTGGTAACCTAGCACACGCTGGGGCGTCCGTTGATTTAACCATCTTCTCCCTACACCTCGCAGGGGTTTCCTCCATCCTTGGGGCCATTAATTTCATCACAACAATCCTCAACATAAAACCCCCCGCTATATCTCAATACCAAACCCCTCTCTTCGTTTGATCCGTCCTAATTACAGCGGTTCTACTTCTTTTATCCCTTCCCGTCCTCGCAGCTGGGATTACCATGCTCCTTACCGATCGGAACCTGAACACAACCTTCTTCGACCCTGCAGGAGGGGGTGACCCTATTCTGTACCAGCATTTATTCTGATTCTTC

    • Visit BOLD Systems Website
    University of the Philippines Mindanao, Mintal, Tugbok District, Davao City © ABRAHAM Program 2024 - All Rights Reserved. 640 visit(s) today - 171704 total visits (346 average daily visits): 2023-05-22 - 2024-09-29 (496 days)