Chaetodon kleinii | University of the Philippines Mindanao | Marine Biodiversity Database Project
Chaetodon kleinii
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Perciformes
  • Family » Chaetodontidae
  • Genus » Chaetodon
  • Species » Lepidochaetodon
  • Chaetodon kleinii
    (Sunburst butterflyfish)
  • Description »   (Wikipedia) The sunburst butterflyfish (Chaetodon kleinii), also known as the black-lipped butterflyfish, "blacklip butterflyfish" or Klein's butterflyfish, is a species of marine ray-finned fish, a butterflyfish belonging to the family Chaetodontidae. This is an Indo-Pacific species of reef habitats.
    Full article at Wikipedia
  • Local Name »  
  • Locality/Distribution »   [Sasa, Davao del Sur, Davao City]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   FDP_IGCS_2202_047B
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524313
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Sept. 15, 2024, 11:36 p.m.
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GATATCGGCACCCTTTATCTAGTATTTGGTGCTTGAGCTGGAATAGTAGGCACTGCCTTAAGCCTTCTCATCCGAGCAGAGCTCAGTCAACCAGGCACCCTTCTAGGCGACGACCAAATTTATAATGTCATCGTCACGGCGCATGCGTTCGTAATAATTTTCTTTATAGTAATACCAATTATGATTGGAGGCTTTGGAAACTGACTAATTCCTCTAATGATTGGTGCTCCCGACATGGCTTTCCCTCGAATAAACAACATGAGCTTTTGACTCCTGCCCCCTTCTTTCTTCCTCCTGCTTGCCTCGTCTGGCGTAGAGTCCGGGGCTGGAACAGGATGAACCGTCTACCCCCCACTGGCCGGCAACCTGGCCCACGCCGGAGCATCAGTTGATTTAACCATCTTCTCCCTACACCTTGCGGGGATTTCATCTATTCTTGGGGCTATTAACTTCATCACAACAATTCTTAACATGAAACCGCCTGCGATGTCTCAGTATCAGACCCCCCTGTTCGTATGATCTGTTCTAATTACAGCTGTCCTCCTTCTTCTGTCTCTACCTGTCCTTGCGGCCGGTATTACAATGCTTCTAACGGACCGAAACCTAAACACAACCTTCTTTGATCCAGCAGGAGGAGGAGACCCTATTTTATACCAGCATCTGTTCTGATTCTTC

    • Visit BOLD Systems Website
    University of the Philippines Mindanao, Mintal, Tugbok District, Davao City © ABRAHAM Program 2024 - All Rights Reserved. 609 visit(s) today - 171673 total visits (346 average daily visits): 2023-05-22 - 2024-09-29 (496 days)