Thalassoma lunare | University of the Philippines Mindanao | Marine Biodiversity Database Project
Thalassoma lunare
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Labriformes
  • Family » Labridae
  • Genus » Thalassoma
  • Species » lunare
  • Thalassoma lunare
    (Moon wrasse)
  • Description »   (Wikipedia) The moon wrasse (Thalassoma lunare) also known as the crescent wrasse or lyretail wrasse, is a species of wrasse native to the Indian Ocean and the western Pacific Ocean. It is an inhabitant of coral reefs and surrounding areas at depths from 1 to 20 m (3.3 to 65.6 ft). Moon wrasses are carnivorous and tend to prey on fish eggs and small sea-floor dwelling invertebrates. This species can reach 45 cm (18 in) in total length. It is of minor importance to local commercial fisheries and can also be found in the aquarium trade.
    Full article at Wikipedia
  • Local Name »  
  • Locality/Distribution »   [Sasa, Davao del Sur, Davao City]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   FDP_IGCS_2202_049C
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524701
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Sept. 15, 2024, 11:34 p.m.
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GATATCGGCACCCTCTACCTTGTGTTCGGCGCATGAGCCGGGATGGTAGGGACAGCCCTGAGCCTGCTCATTCGAGCAGAATTAAGCCAGCCCGGCGCCCTCCTTGGAGACGACCAAATTTATAACGTCATCGTCACAGCCCATGCATTCGTCATAATTTTCTTTATAGTAATACCAATTATGATTGGCGGATTCGGAAACTGACTTATTCCCCTAATGATTGGCGCCCCCGATATGGCCTTCCCTCGTATGAACAATATGAGCTTTTGGCTTCTCCCCCCTTCATTCCTTCTCCTTCTCGCTTCTTCTGGTGTTGAAGCGGGGGCCGGGACCGGATGAACAGTCTACCCACCCCTAGCAGGTAACCTTGCCCACGCTGGCGCATCCGTTGATCTAACCATCTTCTCCCTACATCTGGCAGGTATTTCATCAATTTTAGGTGCAATTAACTTCATTACAACTATTATTAACATGAAACCCCCAGCCATCTCTCAATACCAAACGCCTCTTTTCGTATGGGCCGTTCTAATTACAGCAGTCCTTCTTCTGCTCTCTCTTCCAGTGCTTGCTGCCGGCATTACAATGCTCCTGACGGACCGAAATCTAAACACTACCTTCTTTGACCCAGCTGGAGGAGGGGACCCAATTCTTTACCAACATCTGTTCTGATTTTTT

    • Visit BOLD Systems Website
    University of the Philippines Mindanao, Mintal, Tugbok District, Davao City © ABRAHAM Program 2024 - All Rights Reserved. 333 visit(s) today - 171397 total visits (346 average daily visits): 2023-05-22 - 2024-09-29 (496 days)