Neoniphon aurolineatus | University of the Philippines Mindanao | Marine Biodiversity Database Project
Neoniphon aurolineatus
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Holocentriformes
  • Family » Holocentridae
  • Genus » Neoniphon
  • Species » aurolineatus
  • Neoniphon aurolineatus
    (Yellowstriped squirrelfish)
  • Description »   (Wikipedia) Neoniphon aurolineatus, more commonly known as the yellowstriped squirrelfish or gold-lined squirrelfish, is a member of the family Holocentridae. It has a wide range throughout the Indian and Pacific Oceans stretching east from Mauritius to Hawaii and south from Japan to the Great Barrier Reef of Australia. It lives on the outer reef slopes at depths between 30 and 188 metres (98 and 617 ft). It lives near the ocean floor or in caves, generally staying alone or in small groups. It feeds on crustaceans and can reach sizes of up to 25.0 centimetres (9.8 in) TL. It is listed as "Least Concern" by the IUCN due to its deep-water habitat and lack of known major threats.
    Full article at Wikipedia
  • Local Name »  
  • Locality/Distribution »   [Mati City, Davao Oriental]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   FDP_MATI_2202_004A
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524527
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Sept. 15, 2024, 11:21 p.m.
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GATATTGGCACCCTCTATCTAGTATTCGGTGCCTGAGCTGGCATAGTCGGCACAGCTCTCAGCCTTCTTATTCGAGCTGAACTGAGCCAACCCGGAGCTCTTCTGGGAGATGACCAGATTTATAATGTTATTGTTACGGCACACGCATTTGTAATAATTTTCTTTATAGTAATACCAATCATGATCGGAGGTTTTGGAAACTGACTAATTCCCTTAATAATCGGAGCCCCTGACATGGCATTCCCCCGAATAAATAATATGAGCTTCTGACTTCTTCCCCCCTCATTCCTACTTTTACTAGCCTCTTCAGGAGTAGAGGCTGGTGCCGGGACAGGATGAACTGTATACCCACCCCTTGCAGGTAATTTAGCACACGCGGGGGCTTCTGTAGACTTAACTATTTTCTCGCTCCACCTAGCGGGTATTTCATCAATCCTGGGGGCTATTAATTTTATTACAACCATTATCAACATGAAACCCCCTGCAATTTCACAATATCAAACACCACTGTTTGTATGAGCCGTCCTAATCACGGCTGTTCTTCTTCTCCTATCTCTACCCGTATTAGCAGCAGGTATTACCATGCTACTAACAGATCGAAATCTAAACACAACATTCTTCGACCCAGCAGGCGGGGGAGACCCAATTCTTTACCAGCACTTATTCTGATTCTTC

    • Visit BOLD Systems Website
    University of the Philippines Mindanao, Mintal, Tugbok District, Davao City © ABRAHAM Program 2024 - All Rights Reserved. 386 visit(s) today - 305317 total visits (553 average daily visits): 2023-05-22 - 2024-11-24 (552 days)