Calotomus spinidens | University of the Philippines Mindanao | Marine Biodiversity Database Project
Calotomus spinidens
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Labriformes
  • Family » Scaridae
  • Genus » Calotomus
  • Species » spinidens
  • Calotomus spinidens
    (Spinytooth parrotfish)
  • Description »  

    Marine; reef-associated; depth range 1 - 72 m . Tropical; 30°N - 30°S

    Maturity: Lm 10.5  range ? - ? cm Max length : 30.0 cm TL male/unsexed;

    Dorsal spines (total): 9; Dorsal soft rays (total): 10; Anal spines: 3; Anal soft rays: 9; Vertebrae: 25. General body color when fresh is greenish brown with scales finely flecked with pale; shade of white ventrally (belly sometimes dull rose or yellowish). Across the chin, 2 irregular dull reddish bars interspaced by white or yellow; upper opercular margin with a diffused dark spot. Hyaline pectorals with a yellowish flush; pelvic fins hyaline except for numerous small white spots and some reddish blotches. Flexible dorsal spines. Area circumscribed by pectoral fin unspotted. Lateral line interrupted (scales usually 19 + 7, occasionally 19 + 6). Body shape (shape guide): fusiform / normal;  Cross section: compressed.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [Mati City, Davao Oriental] [Sasa, Davao City, Davao Del Sur]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   [FDP_MATI_2202_016A] [FDP_IGCS_2201_019B]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:17 September 2009 (FishBase)
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524276
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Nov. 28, 2024, 12:55 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GATATCGGCACCCTTTACCTAGTGTTTGGTGCCTGGGCCGGAATAGTCGGAACTGCTTTAAGTCTACTGATTCGAGCCGAATTAAGCCAACCTGGAGCTCTCCTCGGGGACGATCAAATCTATAATGTAATTGTTACGGCCCACGCATTCGTAATAATTTTCTTTATAGTCATGCCTATCATGATCGGAGGTTTCGGGAACTGACTCATCCCTCTAATGATTGGAGCCCCTGACATGGCCTTCCCTCGAATAAACAACATAAGCTTCTGACTCCTTCCGCCTTCTTTCCTCTTACTTCTTGCCTCCTCCGGCGTAGAGGCTGGGGCGGGGACGGGATGAACCGTATATCCTCCCCTGGCGGGGAATCTTGCTCATGCAGGGGCCTCCGTAGACTTAACCATTTTCTCGCTTCATCTCGCAGGGATCTCGTCAATCCTCGGAGCAATCAATTTTATTACTACAATCATCAATATGAAGCCACCTGCCATCTCTCAATACCAGACGCCTCTCTTCGTATGAGCAGTTCTAATCACTGCCGTCCTTCTTCTTCTTTCACTTCCCGTGCTGGCCGCAGGCATCACCATGCTATTAACGGATCGAAACTTGAATACTACATTCTTTGACCCAGCAGGCGGGGGAGACCCAATTCTTTACCAACACCTATTCTGATTCTTC