Oxycheilinus orientalis | University of the Philippines Mindanao | Marine Biodiversity Database Project
Oxycheilinus orientalis
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Perciformes
  • Family » Labridae
  • Genus » Oxycheilinus
  • Species » orientalis
  • Oxycheilinus orientalis
  • Description »  

    Marine; reef-associated; depth range 0 - 80 m . Tropical; 30°N - 15°S

    Maturity: Lm ?  range ? - ? cm Max length : 20.0 cm TL male/unsexed;

    Dorsal spines (total): 9; Dorsal soft rays (total): 10; Anal spines: 3; Anal soft rays: 8; Vertebrae: 23. Color of large adults red in life; body usually with 5 indistinct narrow pale bars that may contain white flecks, and 2 faint pale stripes along side; irregular bright red vertical lines on edges of scales anteriorly on midside and lower part of body, along with red dots; head with white to pale blue-green transverse lines on side of lower jaw, widest near front of chin; side of snout and head below eye with small dark-edged white to pale blue-green spots; iris orange-yellow with a blue ring, hind edge of eye black with a bright blue-green spot above (shows when eye directed forward); a blackish smudge on 2nd and 3rd lateral-line scales may be present (not related to sex); dorsal and anal fins light orange-red with oblique red lines and dark-edged white to blue lines or rows of dashes or small spots, the dorsal sometimes blackish on 1st membrane, rarely with a broad dusky border; caudal fin red with small white spots, often with an irregular blotchy white bar near base; pectoral fins with dark-edged pale yellowish rays and clear membranes; pelvic fins translucent whitish, blotched with red and flecked with white. Color of small adults light red, finely flecked with pink dorsally and white ventrally, with an orange-yellow stripe from chin to eye and along side of body to midbase of caudal fin; stripe on body broadly bordered above and below with a broad whitish band; edges of scales along midside of body with vertical red lines; two small midlateral bright red spots, one below middle of soft portion of dorsal fin and the other on base of caudal fin . Body shape (shape guide): fusiform / normal;  Cross section: compressed.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [Mati City, Davao Oriental]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   [FDP_MATI_2202_018A]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:25 March 2009 (FishBase)
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524540
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Nov. 28, 2024, 12:56 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    TATCTCGACACCTTCTATTTTGTTTTCGGTGCCTGAGCCGGAATGGTGGGCACAGCCCTAAGCCTGCTTATCCGAGCAGAACTCAGCCAGCCAGGAGCCCTTCTTGGAGACGACCAGATCTACAACGTCATCGTTACAGCCCACGCCTTCGTCATGATCTTTTTTATAGTAATGCCAATTATGATCGGTGGGTTTGGAAACTGGCTTATCCCACTGATAATCGGAGCCCCCGATATGGCCTTTCCCCGAATGAACAACATGAGCTTCTGACTCCTGCCCCCTTCTTTCCTCCTCCTCCTCGCTTCCTCCGGAGTCGAAGCAGGGGCCGGCACCGGATGAACAGTTTACCCCCCACTGTCAGGGAACTTAGCACACGCCGGCGCCTCTGTAGACTTAACTATCTTCTCTCTTCACTTAGCAGGGATTTCTTCTATTCTTGGGGCCATTAACTTTATTACTACTATTATTAACATAAAGCCCCCAGCCATCACCCAATACCAAACCCCCCTCTTTGTCTGAGCGGTCCTAATTACCGCCGTCCTCCTACTCCTCTCTCTCCCTGTCCTAGCCGCAGGCATTACAATGCTCTTAACAGACCGAAACCTAAACACCACCTTTTTCGACCCAGCCGGGGGAGGTGACCCGATCCTCTATCAACACCTATTCTGATTCTTC