Lethrinus erythropterus | University of the Philippines Mindanao | Marine Biodiversity Database Project
Lethrinus erythropterus
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Spariformes
  • Family » Lethrinidae
  • Genus » Lethrinus
  • Species » erythracanthus
  • Lethrinus erythropterus
    (Longfin emperor)
  • Description »  

    Marine; reef-associated; non-migratory; depth range 15 - 120 m . Tropical; 30°N - 23°S

    Maturity: Lm ?, range 25 - ? cm Max length : 70.0 cm TL male/unsexed; ; common length : 50.0 cm TL male/unsexed;

    Dorsal spines (total): 10; Dorsal soft rays (total): 9; Anal spines: 3; Anal soft rays: 8. The largest species of Lethrinus distinguished by the following characters: body moderately deep, its depth 2.5-2.7 times in standard length (SL); head length 0.9-1 times in body depth, 2.5-2.8 times in SL; dorsal profile near eye nearly straight or slightly convex; snout moderately short, its length about 1.8-2.4 times in HL, measured without the lip the snout is 0.8-1.1 times in cheek height, its dorsal profile distinctly concave in large individuals and nearly straight in smaller individuals, snout angle relative to upper jaw between 55° and 69°; interorbital space convex; posterior nostril an oblong longitudinal opening, closer to orbit than anterior nostril; eye situated close to or far removed from dorsal profile, its length 2.7-5.2 times in HL; cheek moderately high, its height 2-3.4 times in HL; lateral teeth in jaws conical; outer surface of maxilla smooth or with a longitudinal ridge; D X,9 with 4th or 5th dorsal-fin spine the longest, its length 2.5-3.5 times in body depth; A III,8 with the 3rd, 4th or 5th soft ray usually the longest, its length much longer than length of base of soft-rayed portion of anal fin and 0.8-1.1 times in length of entire anal-fin base; pectoral-fin rays 13; pelvic-fin membranes between rays closest to body with or without dense melanophores; cheek without scales; 46-48 lateral-line scales; 4 ½ scale rows between lateral line and base of middle dorsal-fin spines; 15-18 scale rows in transverse series between origin of anal fin and lateral line; usually 15 rows in lower series of scales around caudal peduncle; 5-8 scales in supratemporal patch; inner surface of pectoral-fin base densely covered with scales; posterior angle of operculum fully scaly. Colour of body brown to dark grey, with indistinct scattered small dark and light spots, with irregular light stripes sometimes on lower sides; head brown or grey, often with many small orange spots on cheeks; pectoral and pelvic fins white to orangish, dorsal and anal fins mottled orange and bluish; caudal fin often bright orange . Body shape (shape guide): fusiform / normal;  Cross section: oval.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [Mati City, Davao Oriental]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   [FDP_MATI_2202_026A]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:09 March 2015 (FishBase)
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524443
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Nov. 28, 2024, 1 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GATATCGGCACCCTTTATTTAGTATTTGGTGCCTGAGCTGGCATGGTAGGGACAGCCCTAAGCCTACTTATTCGAGCAGAACTTAGCCAACCTGGGGCACTCCTAGGAGACGACCAGATTTATAATGTTATTGTTACGGCCCACGCCTTTGTAATAATCTTCTTTATGGTCATACCTATCATGATCGGAGGCTTTGGCAATTGGCTTATCCCCCTAATGATCGGAGCCCCTGATATGGCATTCCCACGAATAAATAACATGAGCTTTTGACTGTTACCCCCCTCATTCCTCCTCCTGCTTGCATCCTCAGGCGTAGAAGCTGGGGCTGGAACAGGATGAACAGTCTACCCCCCACTAGCAGGCAACCTCGCCCATGCAGGTGCATCCGTAGACCTAACAATCTTCTCACTCCACTTAGCAGGGGTCTCCTCAATTCTAGGAGCCATCAATTTCATTACAACAATTATTAACATGAAACCTCCAGCTATTTCTCAATATCAAACACCTCTATTTGTTTGAGCGGTTCTAATTACCGCTGTTCTTCTTCTACTATCCCTGCCCGTTCTTGCTGCCGGTATTACAATGCTATTAACAGACCGAAACCTAAACACCACCTTCTTCGACCCTGCAGGAGGAGGCGACCCAATTCTATACCAACATCTCTTCTGATTCTTC