Parupeneus barberinoides | University of the Philippines Mindanao | Marine Biodiversity Database Project
Parupeneus barberinoides
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Perciformes
  • Family » Mullidae
  • Genus » Parupeneus
  • Species » barberinoides
  • Parupeneus barberinoides
    (Bicolor goatfish)
  • Description »  

    Marine; reef-associated; depth range 1 - 100 m . Tropical; 30°N - 25°S

    Maturity: Lm ?  range ? - ? cm Max length : 30.0 cm TL male/unsexed; ; common length : 20.0 cm TL male/unsexed;

    Dorsal spines (total): 8; Dorsal soft rays (total): 9; Anal spines: 1; Anal soft rays: 7. Diagnosis: Pectoral rays 15-16 (usually 15). Gill rakers 6-8 + 20-25 (total 28-32). Body moderately elongate, depth 3.2-3.5 in SL; head length 2.75-3.15 in SL; snout length 1.8-2.0 in HL; barbel length 1.3-1.5 in HL; head and anterior half of body reddish black, posterior half white and yellow with a black spot nearly as large as eye on upper side below rear base of second dorsal fin, followed by small blue spots; a white band from front of snout passing above eye along dorsal part of body, and a second nearly parallel one from corner of mouth to above pectoral fin; caudal fin pale yellow with a broad, dusky lower margin, and often with a small red spot at midbase; barbels red . Body shape (shape guide): fusiform / normal;  Cross section: oval.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [General Santos City, South Cotabato]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   [FDP_SGES_2112_004A]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:11 March 2015 (FishBase)
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524547
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Nov. 20, 2024, 1:03 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GATATCGGCACACTTTATTTAATCTTCGGGGCCTGAGCCGGAATAGTTGGCACAGCCCTAAGTCTCCTTATTCGTGCCGAGCTCGGCCAGCCCGGGGCTCTTCTAGGCGACGATCAAATTTATAACGTCATCGTTACAGCCCACGCCTTTGTAATAATTTTCTTTATAGTGATGCCAATCATGATCGGGGGCTTCGGTAACTGACTCATCCCACTAATGATTGGGGCCCCCGACATGGCCTTCCCTCGGATGAACAACATGAGCTTTTGACTACTTCCCCCCTCCTTCCTTCTCCTACTCGCCTCTTCAGGCGTTGAAGCTGGGGCAGGGACTGGTTGAACAGTCTACCCCCCTCTGGCCGGTAATCTAGCACACGCTGGAGCATCCGTTGACCTGACCATTTTCTCACTCCATCTGGCAGGTATCTCCTCCATCCTTGGGGCCATTAATTTTATTACTACCATTATCAACATGAAACCCCCAGCGATTTCACAATACCAAACGCCTTTATTCGTTTGGGCCGTCCTGATTACTGCCGTCCTCCTTCTTCTGTCGCTTCCAGTCCTTGCCGCCGGTATTACAATGCTACTGACGGACCGAAACCTGAATACAACCTTCTTCGACCCAGCAGGCGGAGGGGATCCTATCCTCTACCAACACCTGTTCTGATTCTTC