Parupeneus barberinoides | University of the Philippines Mindanao | Marine Biodiversity Database Project
Parupeneus barberinoides
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Perciformes
  • Family » Mullidae
  • Genus » Parupeneus
  • Species » barberinoides
  • Parupeneus barberinoides
    (Bicolor goatfish)
  • Description »   (Wikipedia) Parupeneus barberinoides, the bicolor goatfish, is a species of goatfish native to the western Pacific Ocean. An inhabitant of coral reefs, it can be found at depths of from 1 to 40 metres (3.3 to 131.2 ft). This species can reach a length of 30 centimetres (12 in) TL though most are only around 20 centimetres (7.9 in). This is a commercially important species and can also be found in the aquarium trade.
    Full article at Wikipedia
  • Local Name »  
  • Locality/Distribution »   [General Santos City, South Cotabato]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   FDP_SGES_2112_004A
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524547
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Nov. 20, 2024, 1:03 p.m.
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GATATCGGCACACTTTATTTAATCTTCGGGGCCTGAGCCGGAATAGTTGGCACAGCCCTAAGTCTCCTTATTCGTGCCGAGCTCGGCCAGCCCGGGGCTCTTCTAGGCGACGATCAAATTTATAACGTCATCGTTACAGCCCACGCCTTTGTAATAATTTTCTTTATAGTGATGCCAATCATGATCGGGGGCTTCGGTAACTGACTCATCCCACTAATGATTGGGGCCCCCGACATGGCCTTCCCTCGGATGAACAACATGAGCTTTTGACTACTTCCCCCCTCCTTCCTTCTCCTACTCGCCTCTTCAGGCGTTGAAGCTGGGGCAGGGACTGGTTGAACAGTCTACCCCCCTCTGGCCGGTAATCTAGCACACGCTGGAGCATCCGTTGACCTGACCATTTTCTCACTCCATCTGGCAGGTATCTCCTCCATCCTTGGGGCCATTAATTTTATTACTACCATTATCAACATGAAACCCCCAGCGATTTCACAATACCAAACGCCTTTATTCGTTTGGGCCGTCCTGATTACTGCCGTCCTCCTTCTTCTGTCGCTTCCAGTCCTTGCCGCCGGTATTACAATGCTACTGACGGACCGAAACCTGAATACAACCTTCTTCGACCCAGCAGGCGGAGGGGATCCTATCCTCTACCAACACCTGTTCTGATTCTTC

    • Visit BOLD Systems Website
    University of the Philippines Mindanao, Mintal, Tugbok District, Davao City © ABRAHAM Program 2024 - All Rights Reserved. 242 visit(s) today - 305173 total visits (553 average daily visits): 2023-05-22 - 2024-11-24 (552 days)