Scarus spinus | University of the Philippines Mindanao | Marine Biodiversity Database Project
Scarus spinus
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Labriformes
  • Family » Scaridae
  • Genus » Scarus
  • Species » spinus
  • Scarus spinus
    (Greensnout parrotfish)
  • Description »  

    Marine; reef-associated; depth range 0 - 30 m , usually 2 - 15 m . Tropical; 30°N - 24°S

    Maturity: Lm ?  range ? - ? cm Max length : 30.0 cm TL male/unsexed;

    Dorsal spines (total): 9; Dorsal soft rays (total): 10; Anal spines: 3; Anal soft rays: 9. Males distinct and head looks bright yellow underwater; females drab with white teeth and some pale spots . Scales large. 4 median predorsal scales; a transverse pair of smaller scales which overlap medially in mid-dorsal line located directly anterior to 1st median scale; 3 scale rows on cheek, lower row with 1-2 (usually 2) scales. Caudal fin slightly rounded to truncate in initial phase; moderately to deeply emarginate in terminal phase. Adults in initial phase without canines on upper plate, 1 on lower; terminal-phase fish with 1-2 canines on upper and lower plates. Lips largely or entirely cover dental plates. Body shape (shape guide): elongated;  Cross section: compressed.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [General Santos City, South Cotabato]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   [FDP_SGES_2112_011A]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:19 September 2009 (FishBase)
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524646
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Nov. 28, 2024, 1:08 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GATATTGGCACCCTCTACCTTGTATTTGGTGCCTGAGCCGGAATAGTAGGCACTGCCTTAAGCCTTCTCATCCGAGCTGAACTAAGCCAACCCGGGGCCCTCCTTGGGGATGATCAAATTTATAATGTTATCGTCACGGCTCACGCATTTGTAATGATCTTTTTTATGGTCATACCCATCATAATTGGAGGCTTTGGAAATTGACTTATCCCACTCATGATCGGGGCACCTGACATGGCCTTCCCTCGAATAAATAACATAAGCTTCTGACTTCTCCCACCCTCCTTTCTACTGTTACTCGCCTCCTCTGGCGTAGAAGCAGGGGCAGGAACCGGGTGGACCGTCTACCCCCCTCTGGCAGGGAATCTTGCACACGCAGGAGCATCCGTCGACCTAACAATCTTCTCTCTCCACCTGGCCGGAATTTCCTCAATCCTAGGGGCAATCAACTTTATTACAACTATCATTAACATGAAACCGCCCGCCATCTCTCAGTACCAGACCCCACTATTCGTGTGGGCTGTTTTAATCACTGCCGTGCTTCTCCTCCTCTCACTCCCTGTTCTCGCTGCAGGGATCACAATGCTACTCACAGATCGAAATCTAAACACCACCTTCTTCGACCCTGCAGGTGGGGGAGACCCAATTCTTTATCAACACCTATTTTGATTCTTC