Bothus pantherinus | University of the Philippines Mindanao | Marine Biodiversity Database Project
Bothus pantherinus
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Pleuronectiformes
  • Family » Bothidae
  • Genus » Bothus
  • Species » pantherinus
  • Bothus pantherinus
    (Leopard flounder)
  • Description »  

    Marine; reef-associated; depth range 3 - 150 m . Tropical; 32°N - 32°S, 26°E - 138°W

    Maturity: Lm ?  range ? - ? cm Max length : 39.0 cm TL male/unsexed; ; common length : 20.0 cm TL male/unsexed;

    Dorsal spines (total): 0; Dorsal soft rays (total): 84 - 97; Anal spines: 0; Anal soft rays: 61 - 73. Eyed side with dark spots, blotches and rings on body and median fins; 1 distinct dark blotch on middle of straight section of lateral line; narrow dark crossbars on eyed side of pectorals . Pectoral rays 9-12 (eyed side) and 9-11 (blind side).

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [General Santos City, South Cotabato]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   [FDP_SGES_2112_019A]
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:03 March 2015 (FishBase)
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524264
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Nov. 28, 2024, 1:10 p.m.
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GATATTGGCACCCTGTACCTCGTATTTGGTGCTTGAGCAGGCATGGTTGGGACAGCACTCAGCCTTCTTATTCGAGCAGAGCTTAGCCAGCCGGGAGCACTGCTCGGTGATGACCAGATCTATAACGTCATTGTCACGGCCCACGCCTTTGTGATAATCTTCTTTATAGTAATGCCTATTATGATCGGAGGCTTCGGCAACTGGCTGATCCCCCTAATGGTGGGGGCCCCGGACATGGCCTTCCCCCGTATGAATAACATGAGCTTCTGACTGCTGCCCCCCTCATTTCTCCTACTACTCGCCTCCTCGGGCGTAGAGGCGGGGGCGGGGACCGGGTGGACTGTCTACCCCCCTCTGGCCGGCAATCTTGCCCACGCGGGAGCATCAGTGGACTTGACTATCTTCTCTCTTCATCTTGCAGGCATTTCATCCATCCTCGGGGCTATCAATTTCATTACAACAATTCTAAACATGAAACCACCAGCCATGACAATGTACCAAGTGCCTCTGTTCGTCTGAGCGGTACTAATCACTGCAGTTCTTCTGCTTCTCTCACTCCCTGTTCTCGCTGCTGGGATTACCATGCTCTTAACAGACCGGAACCTGAACACCACTTTCTTTGACCCGGCCGGAGGGGGCGACCCCATCCTATACCAACACCTATTCTGATTCTTC

    • Visit FishBase Website
    Visit BOLD Systems Website
    University of the Philippines Mindanao, Mintal, Tugbok District, Davao City © ABRAHAM Program 2025 - All Rights Reserved. 4795 visit(s) today - 560313 total visits (820 average daily visits): 2023-05-22 - 2025-04-04 (683 days)