Gymnocranius griseus | University of the Philippines Mindanao | Marine Biodiversity Database Project
Gymnocranius griseus
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Spariformes
  • Family » Lethrinidae
  • Genus » Gymnocranius
  • Species » griseus
  • Gymnocranius griseus
    (Grey large-eye bream)
  • Description »   (Wikipedia) Gymnocranius griseus, the grey large-eye bream, barred large-eye bream, grey emperor, grey seabream and naked-head seabream, is a species of marine ray-finned fish belonging to the family Lethrinidae, the emperors and emperor breams. This species is found in the Indian and Pacific Oceans.
    Full article at Wikipedia
  • Local Name »  
  • Locality/Distribution »   [General Santos City, South Cotabato]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   FDP_SGES_2112_025A
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524405
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Sept. 15, 2024, 10:04 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GATATTGGCACCCTCTATTTAGTATTCGGTGCATGAGCTGGAATAGTAGGAACCGCCCTAAGCCTTCTCATCCGAGCGGAACTTAGTCAACCAGGCGCTCTCCTGGGGGACGACCAGATTTACAATGTAATCGTTACAGCACACGCCTTCGTAATGATTTTCTTTATAGTAATACCAATTATGATCGGAGGCTTTGGAAATTGACTTATCCCCCTAATGATCGGGGCCCCTGACATGGCATTCCCTCGAATGAACAACATGAGCTTTTGACTTCTCCCCCCTTCCTTCCTACTGCTCCTAGCCTCCTCAGGCATTGAAGCCGGAGCAGGTACCGGATGAACAGTCTACCCCCCACTAGCTGGTAACCTTGCTCACGCTGGAGCATCTGTTGACTTAACCATTTTCTCCCTCCACCTAGCTGGCATCTCCTCGATCCTGGGGGCTATTAATTTTATTACAACCATCATCAATATAAAACCCCCCGCCATCTCTCAATACCAGACCCCTCTTTTCGTTTGAGCAGTCCTAATCACTGCTGTCCTTCTCCTCCTTTCGCTGCCAGTCTTAGCCGCAGGCATCACAATACTCCTCACGGACCGAAACTTAAACACAACTTTCTTTGACCCAGCAGGCGGGGGGGACCCGATTCTTTACCAGCACCTATTCTGATTCTTC