Gerres oyena | University of the Philippines Mindanao | Marine Biodiversity Database Project
Gerres oyena
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Perciformes
  • Family » Gerreidae
  • Genus » Gerres
  • Species » oyena
  • Gerres oyena
    (Common silver-biddy)
  • Description »  

    Marine; brackish; reef-associated; depth range 0 - 20 m . Tropical; 36°N - 35°S, 25°E - 174°W

    Maturity: Lm ?, range 22 - ? cm Max length : 30.0 cm TL male/unsexed; ; common length : 20.0 cm SL male/unsexed;

    Dorsal spines (total): 9; Dorsal soft rays (total): 10; Anal spines: 3; Anal soft rays: 7. Body silvery with 6-8 irregular, faint dusky oblique and vertical bands dorsolaterally and ventrolaterally (usually more apparent in young stressed or preserved specimens. U-shaped premaxilla groove mostly without scales (tiny scales anteriorly in specimens over 13 cm SL). Posterior margin of maxillary beyond a vertical through anterior margin of pupil. Supraneural bones 3. Spinous dorsal fin with an indistinct dusky patch (2nd-6th spines) and very narrow dusky distal margins on upper membranes between spines. Scales between 5th dorsal fin spine and lateral line 3-4, usually 3.5. Pelvic fin when fresh is semi-transparent or dull yellow color with an indistinct dusky band and dull white distal margin posteriorly ; pectoral fins reaches beyond level of anus; caudal fin forked deeply and with long lobes . Body shape (shape guide): fusiform / normal;  Cross section: compressed.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [General Santos City, South Cotabato]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   [FDP_SGES_2112_038C]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:02 March 2015 (FishBase)
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524399
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Nov. 28, 2024, 1:20 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GATATTGGCACCCTCTACCTTGTCTTCGGTGCTTGAGCTGGAATGGTAGGCACAGCCTTGAGCCTACTCATCCGAGCTGAGCTAAGCCAACCCGGCTCTCTCTTAGGAGATGACCAAATCTACAATGTCATTGTTACGGCTCACGCATTCGTAATAATTTTTTTTATAGTAATACCAATCATGATTGGAGGCTTCGGAAACTGACTGATCCCACTAATGATCGGAGCCCCAGATATGGCATTCCCCCGAATGAACAATATGAGCTTCTGACTTCTCCCTCCTTCATTCTTGCTTCTCTTGGCCTCTTCAGGCGTAGAGGCCGGAGCCGGAACGGGATGAACCGTCTACCCCCCTCTATCTGGAAATTTAGCCCATGCTGGAGCATCCGTCGACCTAACAATTTTCTCTCTCCACCTGGCGGGTATTTCATCAATCTTAGGAGCTATCAATTTCATCACCACTATCATCAACATAAAACCACCAGCCATTTCTCAGTACCAAACACCCCTTTTCGTCTGAGCAGTGCTAATTACCGCAGTTCTTCTTCTCCTCTCACTTCCTGTCCTAGCTGCTGGTATTACTATGCTTCTGACAGACCGAAACCTGAACACTACTTTCTTCGACCCTGCAGGAGGTGGTGACCCAATCCTTTACCAACACCTATTCTGATTCTTC