Gerres oyena | University of the Philippines Mindanao | Marine Biodiversity Database Project
Gerres oyena
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Perciformes
  • Family » Gerreidae
  • Genus » Gerres
  • Species » oyena
  • Gerres oyena
    (Common silver-biddy)
  • Description »   (Wikipedia) The common silver-biddy (Gerres oyena), also known as the blacktip silver biddy, Darnley Island silverbelly, longtail silverbiddy, oceanic silver biddy, shining silver-belly or slender silver belly, is a species of mojarra native to marine and brackish waters of coastal waters of the Indian Ocean and the western Pacific Ocean. It inhabits estuaries, coastal waters and lagoons. This species can reach a length of 30 cm (12 in), though most do not exceed 20 cm (7.9 in). This species is important to local commercial fisheries.
    Full article at Wikipedia
  • Local Name »  
  • Locality/Distribution »   [General Santos City, South Cotabato]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   FDP_SGES_2112_038C
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524399
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Sept. 15, 2024, 9:52 p.m.
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GATATTGGCACCCTCTACCTTGTCTTCGGTGCTTGAGCTGGAATGGTAGGCACAGCCTTGAGCCTACTCATCCGAGCTGAGCTAAGCCAACCCGGCTCTCTCTTAGGAGATGACCAAATCTACAATGTCATTGTTACGGCTCACGCATTCGTAATAATTTTTTTTATAGTAATACCAATCATGATTGGAGGCTTCGGAAACTGACTGATCCCACTAATGATCGGAGCCCCAGATATGGCATTCCCCCGAATGAACAATATGAGCTTCTGACTTCTCCCTCCTTCATTCTTGCTTCTCTTGGCCTCTTCAGGCGTAGAGGCCGGAGCCGGAACGGGATGAACCGTCTACCCCCCTCTATCTGGAAATTTAGCCCATGCTGGAGCATCCGTCGACCTAACAATTTTCTCTCTCCACCTGGCGGGTATTTCATCAATCTTAGGAGCTATCAATTTCATCACCACTATCATCAACATAAAACCACCAGCCATTTCTCAGTACCAAACACCCCTTTTCGTCTGAGCAGTGCTAATTACCGCAGTTCTTCTTCTCCTCTCACTTCCTGTCCTAGCTGCTGGTATTACTATGCTTCTGACAGACCGAAACCTGAACACTACTTTCTTCGACCCTGCAGGAGGTGGTGACCCAATCCTTTACCAACACCTATTCTGATTCTTC

    • Visit BOLD Systems Website
    University of the Philippines Mindanao, Mintal, Tugbok District, Davao City © ABRAHAM Program 2024 - All Rights Reserved. 185 visit(s) today - 305116 total visits (553 average daily visits): 2023-05-22 - 2024-11-24 (552 days)