Upeneus tragula | University of the Philippines Mindanao | Marine Biodiversity Database Project
Upeneus tragula
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Perciformes
  • Family » Mullidae
  • Genus » Upeneus
  • Species » tragula
  • Upeneus tragula
    (Freckled goatfish)
  • Description »  

    Marine; brackish; reef-associated; oceanodromous ; depth range 0 - 42 m . Tropical; 30°N - 30°S, 92°E - 16°W

    Maturity: Lm 11.0, range 10 - ? cm Max length : 30.0 cm TL male/unsexed;

    Dorsal spines (total): 8; Dorsal soft rays (total): 9; Anal spines: 1; Anal soft rays: 6. This species is distinguished by the following characters: D VIII + 9; pectoral fins 12-14; gill rakers 4-7 + 15-19 = 20-25; lateral line scales 28-31; the following measurements are in %SL- body depth at first dorsal fin origin 21-28 and at anus 18-24; caudal-peduncle depth 9.5-12, width 3.1-4.9L; maximum head depth 18-24; head depth through eye 14-20; head length 26-32; postorbital length 9.9–13; orbit length 5.3-8.9; upper jaw length 9.8-14; barbel length 13-21; caudal-peduncle length 22-27, caudal-fin length 29-34; anal-fin height 16-20; pelvic-fin length 19-24; pectoral-fin length 17-22, width 3.5-5.3; first dorsal-fin height 20-25; second dorsal-fin height 17-21; postorbital length 1.4–2.0 times in anal-fin height; all fins with red, brown or black stripes, bars or blotches; 7–19 oblique bars on caudal fin, 3-9 bars on upper lobe, 4-10 on lower lobe; first dorsal fin with a large blotch around tip; one red, brown or black mid-lateral body stripe from tip of snout through eye to caudal base; body and head ground colour white or beige, slightly darker above lateral line, with irregular red, brown or black spots and/or blotches; yellow barbels but may be pale brown or orange in fresh fish; most of body and fin pigmentation retained on preserved fish . Body shape (shape guide): fusiform / normal;  Cross section: oval.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [General Santos City, South Cotabato] [Sasa, Davao City, Davao Del Sur] [Sasa, Davao City, Davao del Sur] [Sasa, Davao City, Davao del Sur]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   [FDP_SGES_2112_039A] [FDP_IGCS_2201_013A] [FDP_IGCS_2201_013B] [FDP_IGCS_2202_004A]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:11 March 2015 (FishBase)
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524712
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Nov. 28, 2024, 12:47 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GATATTGGCACCCTTTACCTAGTCTTCGGTGCTTGGGCCGGAATGGTAGGAACTGCTTTAAGCCTCCTCATTCGTGCCGAACTAGCCCAACCTGGGGCTCTCCTGGGCGACGACCAGATTTATAATGTAATCGTCACAGCCCACGCCTTTGTAATGATTTTCTTCATGGTAATGCCTATCATGATCGGAGGATTTGGCAACTGACTTATCCCTCTAATGATTGGTGCACCAGACATGGCCTTCCCTCGTATGAACAATATGAGCTTCTGGCTACTCCCCCCTTCTTTCCTCCTACTACTCGCCTCCTCAGGCGTTGAAGCAGGGGCTGGGACAGGTTGAACTGTTTACCCTCCTTTAGCAGGCAACCTTGCACACGCCGGGGCCTCTGTTGATCTCACTATTTTCTCCCTACACCTAGCGGGGATTTCCTCTATTCTAGGGGCCATCAATTTTATTACAACAATTATCAACATGAAACCTCCAGCAATTTCACAATATCAGACACCTCTATTCGTCTGAGCCGTGCTAATTACGGCTGTCCTTCTCCTTCTTTCCCTACCAGTTCTTGCTGCGGGGATTACTATGCTGCTTACAGATCGAAATCTGAATACTACCTTCTTCGACCCAGCAGGTGGAGGGGACCCCATCCTTTACCAACACCTATTCTGATTCTTC