Sargocentron spiniferum | University of the Philippines Mindanao | Marine Biodiversity Database Project
Sargocentron spiniferum
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Holocentriformes
  • Family » Holocentridae
  • Genus » Sargocentron
  • Species » spiniferum
  • Sargocentron spiniferum
    (Sabre squirrelfish)
  • Description »  

    Marine; reef-associated; depth range 0 - 122 m . Tropical; 31°N - 38°S, 30°E - 124°W

    Maturity: Lm ?  range ? - ? cm Max length : 51.0 cm FL male/unsexed; ; common length : 35.0 cm TL male/unsexed; ; max. published weight: 2.6 kg ; max. reported age: 7 years

    Dorsal spines (total): 11; Dorsal soft rays (total): 14 - 16; Anal spines: 4; Anal soft rays: 9 - 10. Head and body red, scale edges silvery white; spinous dorsal crimson in color; other fins orange-yellow; vertically oblong crimson spot on preopercle behind eye . Five oblique scale rows on cheek; body depth 2.4-2.6 in SL; head length (HL) 2.55-2.85 in SL; lower jaw when closed slightly to moderately projecting; snout length 3.0-3.8 in HL larger than orbit diameter in adults; interorbital width 6.3-8.7 in HL; maxilla extending posteriorly to a vertical at front edge of the orbit; anterior end of nasal bone often with 2 close-set, short spines; medioposterior margin of nasal bone spineless; large nasal fossa spineless on margin; slight ridge of upper edge of suborbital bones weakly serrate; 2 subequal opercular spines; long preopercular spine, usually greater than orbit diameter in specimens at least 20 cm SL; 3rd or 4th dorsal spine longest, 1.7-2.3 in HL; 3rd anal spine 1.7-2.3 in HL .
    Body shape (shape guide): fusiform / normal;  Cross section: compressed.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [Sasa, Davao City, Davao Del Sur]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   [FDP_IGCS_2201_002A]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:04 March 2015 (FishBase)
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524626c
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Nov. 28, 2024, 12:30 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GATATCGGCACCCTTTATTTAGTATTCGGTGCCTGAGCTGGAATAGTTGGTACAGCCCTTAGCCTTCTTATTCGAGCTGAACTTAGCCAGCCTGGAGCTCTCCTGGGAGACGACCAGATTTATAATGTCATTGTTACAGCCCACGCATTTGTAATAATTTTCTTTATAGTAATGCCAATTATGATTGGAGGCTTTGGGAACTGACTAATCCCCCTAATGATTGGAGCCCCTGACATAGCATTCCCTCGAATAAATAACATAAGCTTTTGACTATTACCCCCATCATTCCTTCTTCTACTAGCCTCTTCCGGAGTAGAAGCTGGTGCCGGTACAGGATGAACAGTATACCCACCCCTTGCAGGTAATTTAGCCCACGCAGGGGCTTCTGTTGACCTTACTATTTTCTCACTCCATCTAGCAGGTATTTCTTCAATTCTTGGGGCCATTAATTTTATTACAACTATTATTAACATAAAACCCCCTGCCATTTCCCAATACCAAACTCCCCTATTTGTATGAGCTGTTCTCATCACAGCTGTCCTTCTACTTCTATCCCTACCCGTGCTCGCAGCAGGAATTACCATGCTGCTAACAGACCGAAACCTAAACACAACATTCTTCGACCCAGCAGGAGGTGGAGACCCAATCCTTTACCAACACTTATTCTGATTCTTC