Parupeneus cyclostomus | University of the Philippines Mindanao | Marine Biodiversity Database Project
Parupeneus cyclostomus
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Perciformes
  • Family » Mullidae
  • Genus » Parupeneus
  • Species » cyclostomus
  • Parupeneus cyclostomus
    (Gold-saddle goatfish)
  • Description »  

    Marine; reef-associated; non-migratory; depth range 0 - 125 m . Tropical; 30°N - 35°S, 35°E - 124°W

    Maturity: Lm ?  range ? - ? cm Max length : 50.0 cm TL male/unsexed; ; common length : 35.0 cm TL male/unsexed; ; max. published weight: 2.3 kg

    Dorsal spines (total): 8; Dorsal soft rays (total): 9; Anal spines: 1; Anal soft rays: 7. This species is distinguished by the following characters: pectoral rays 16 (rarely 15 or 17); gill rakers 6-7 + 22-26 = 29-33; body depth 3.25-3.8 in SL (body deeper with growth); head length (HL) 2.85-3.1 in SL; snout long, its length 1.61.8 in HL; eye small, the orbit diameter 5.3-8.95 in HL (SL 118-392 mm); barbels very long, 1.15 in HL to longer than head; longest dorsal spine 1.5-1.7 in HL; penultimate dorsal ray 1.1-1.2 in length of last dorsal ray; pectoral-fin length 1.5-1.7 in HL; pelvic-fin length 1.35-1.55 in HL. Colour of large adults yellowish gray, edges of the scales bright blue except ventrally, edges more broadly blue posteriorly; a large, hemispherical, saddle-like, yellow spot covering most of upper half of caudal peduncle; region around eye yellow with radiating short narrow blue bands; caudal fin with longitudinal blue bands; second dorsal and anal fins with narrow oblique blue bands; a second smaller color phase entirely yellow, with dorsal peduncular spot sometimes apparent by being brighter yellow than rest of body . Body shape (shape guide): fusiform / normal;  Cross section: oval.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [Sasa, Davao City, Davao Del Sur]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   [FDP_IGCS_2112_001A]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:11 March 2015 (FishBase)
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524552
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Nov. 20, 2024, 1:04 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GATATTGGCACCTTATACCTAGTATTTGGTGCTTGAGCCGGAATGGTAGGAACTGCTTTAAGCCTTCTTATTCGAGCCGAGCTAAGTCAACCCGGGGCCCTCCTAGGAGATGACCAAGTCTATAACGTGATCGTTACAGCACATGCCTTTGTAATGATTTTCTTTATAGTAATACCAATCATGATCGGAGGATTCGGCAACTGGCTTATCCCACTTATGGTGGGCGCACCAGACATGGCTTTCCCTCGAATAAACAATATAAGCTTCTGGCTACTTCCCCCCTCTTTCCTCCTCCTCCTTGCCTCTTCAGGCGTTGAAGCCGGGGCAGGGACTGGTTGAACAGTCTACCCACCGCTAGCAGGCAATCTGGCACATGCCGGAGCATCCGTTGACCTAACTATTTTCTCCCTCCACCTAGCAGGTATTTCTTCTATCTTGGGTGCTATTAATTTTATTACAACAATCATTAATATGAAACCCCCCGCAATTTCACAGTACCAGACGCCTCTGTTCGTCTGAGCAGTCCTAATTACGGCCGTCTTACTCCTCCTTTCGCTTCCAGTACTTGCCGCTGGCATTACAATGTTGCTGACAGACCGAAACCTAAATACAACCTTCTTCGACCCAGCAGGGGGAGGAGATCCAATCCTTTACCAGCACCTGTTCTGATTCTTC