Parupeneus cyclostomus | University of the Philippines Mindanao | Marine Biodiversity Database Project
Parupeneus cyclostomus
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Perciformes
  • Family » Mullidae
  • Genus » Parupeneus
  • Species » cyclostomus
  • Parupeneus cyclostomus
    (Gold-saddle goatfish)
  • Description »   (Wikipedia) Parupeneus cyclostomus, commonly known as the Yellow- saddle goatfish, blue goatfish or bright goatfish, is one of 66 currently known species of goatfish. The characteristic yellow patch, or saddle, located on the upper part of the fish’s caudal peduncle, gives the yellow-saddle goatfish their common name. Different life stages of this fish may be found at varying depths, however, most yellow-saddle goatfish remain at around 20 meters of depth or in coastal regions with reefs. They can be found in isolation or small schools, and often rely on each other for hunting purposes. Native to the Indo-Pacific, this reef-dweller occurs primarily in tropical and temperate habitats. It is a commercially important species and has recently been considered an environmental indicator to gauge the impact of habitat modification, coastal degradation, pollution, and commercial fisheries. Yellow- Saddle goatfish, along with other species of goatfish, is of high economic importance in many parts of the world as both a source of food and for the aquarium trade. Goatfish are often sought out as game fish, though they have been reported to carry the ciguatera toxin.
    Full article at Wikipedia
  • Local Name »  
  • Locality/Distribution »   [Sasa, Davao City, Davao Del Sur]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   FDP_IGCS_2112_001A
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524552
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Nov. 20, 2024, 1:04 p.m.
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GATATTGGCACCTTATACCTAGTATTTGGTGCTTGAGCCGGAATGGTAGGAACTGCTTTAAGCCTTCTTATTCGAGCCGAGCTAAGTCAACCCGGGGCCCTCCTAGGAGATGACCAAGTCTATAACGTGATCGTTACAGCACATGCCTTTGTAATGATTTTCTTTATAGTAATACCAATCATGATCGGAGGATTCGGCAACTGGCTTATCCCACTTATGGTGGGCGCACCAGACATGGCTTTCCCTCGAATAAACAATATAAGCTTCTGGCTACTTCCCCCCTCTTTCCTCCTCCTCCTTGCCTCTTCAGGCGTTGAAGCCGGGGCAGGGACTGGTTGAACAGTCTACCCACCGCTAGCAGGCAATCTGGCACATGCCGGAGCATCCGTTGACCTAACTATTTTCTCCCTCCACCTAGCAGGTATTTCTTCTATCTTGGGTGCTATTAATTTTATTACAACAATCATTAATATGAAACCCCCCGCAATTTCACAGTACCAGACGCCTCTGTTCGTCTGAGCAGTCCTAATTACGGCCGTCTTACTCCTCCTTTCGCTTCCAGTACTTGCCGCTGGCATTACAATGTTGCTGACAGACCGAAACCTAAATACAACCTTCTTCGACCCAGCAGGGGGAGGAGATCCAATCCTTTACCAGCACCTGTTCTGATTCTTC

    • Visit BOLD Systems Website
    University of the Philippines Mindanao, Mintal, Tugbok District, Davao City © ABRAHAM Program 2024 - All Rights Reserved. 107 visit(s) today - 305038 total visits (553 average daily visits): 2023-05-22 - 2024-11-24 (552 days)