Lethrinus lentjan | University of the Philippines Mindanao | Marine Biodiversity Database Project
Lethrinus lentjan
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Spariformes
  • Family » Lethrinidae
  • Genus » Lethrinus
  • Species » lentjan
  • Lethrinus lentjan
    (Pink ear emperor)
  • Description »  

    Marine; brackish; reef-associated; non-migratory; depth range 10 - 90 m . Tropical; 32°N - 35°S, 24°E - 167°W

    Maturity: Lm 24.1, range 18 - ? cm Max length : 52.0 cm TL male/unsexed; ; common length : 40.0 cm TL male/unsexed; ; max. reported age: 19 years

    Dorsal spines (total): 10; Dorsal soft rays (total): 9; Anal spines: 3; Anal soft rays: 8. This species is distinguished by the following characters: body moderately deep, its depth 2.5-2.8 times in standard length; head length 0.9-1 times in body depth, 2.6-3 times in SL, dorsal profile near eye nearly straight; snout moderately short, its length about 1.9-2.4 times in HL, measured without the lip the snout is 0.8-1 times in cheek height, its dorsal profile nearly straight, snout angle relative to upper jaw between 60° and 70°; interorbital space convex; posterior nostril an oblong longitudinal opening, closer to orbit than anterior nostril; eye situated close to or far removed from dorsal profile, its length 3.3-4.8 times in HL; cheek not high, its height 2.4-3.1 times in HL; lateral teeth in jaws rounded often with conical tips, or molars often with tubercles; outer surface of maxilla with a longitudinal ridge; D X,9 with the 4th dorsal-fin spine usually the longest, its length 2.4-3.4 times in body depth; A III,8 soft rays, the first soft ray usually the longest, its length almost equal to or shorter than length of base of soft-rayed portion of anal fin and 1-1.2 times in length of entire anal-fin base; pectoral-fin rays 13; pelvic-fin membranes between rays closest to body without dense melanophores; cheek without scales; 46-47 lateral-line scales usually; 5 ½ scale rows between lateral line and base of middle dorsal-fin spines; 15- 16 scale rows in transverse series between origin of anal fin and lateral line; usually 15 rows in lower series of scales around caudal peduncle; 4-9 scales in supratemporal patch; inner surface of pectoral-fin base densely covered with scales, with a few scales, or naked; posterior angle of operculum fully scaly. Colour of body greenish or grey, shading to white below, centers of scales on upper sides often white; posterior margin of opercle and sometimes base of pectoral fins red; pectoral fins white, yellow, or pinkish; pelvic and anal fins white to orange; dorsal fin white and orange mottled with a reddish margin; caudal fin mottled orange or reddish . Body shape (shape guide): fusiform / normal;  Cross section: oval.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [General Santos City, South Cotabato]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   [FDP_SGES_2112_045A]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:09 March 2015 (FishBase)
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524446
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Nov. 28, 2024, 1:22 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    GATATTGGCACCCTTTATTTAGTGTTTGGTGCCTGAGCTGGAATGGTGGGGACAGCCCTAAGCCTACTCATTCGAGCCGAACTTAGCCAACCCGGGGCTCTCCTGGGAGACGACCAAATTTATAATGTTATCGTTACAGCACATGCTTTCGTAATAATCTTCTTTATGGTAATGCCTATTATGATCGGAGGTTTCGGCAACTGGCTCATCCCCCTAATGATTGGAGCCCCCGACATGGCATTCCCCCGAATGAATAACATGAGCTTTTGGCTTCTACCCCCTTCATTCCTTCTCCTACTTGCCTCCTCAGGCGTAGAAGCTGGGGCTGGAACCGGATGAACGGTTTACCCCCCGCTGGCAGGCAACCTTGCCCACGCTGGCGCATCTGTCGACCTGACAATCTTTTCCCTCCACCTAGCGGGGGTTTCCTCAATTTTAGGGGCTATCAACTTCATCACAACAATTATTAATATGAAGCCTCCGGCTATTTCTCAATATCAAACACCGCTGTTTGTATGAGCCGTCCTAATCACCGCCGTATTACTTCTCCTATCCCTACCAGTCCTTGCCGCCGGCATCACAATATTACTGACGGACCGAAACCTAAACACTACCTTCTTTGACCCTGCAGGAGGAGGGGACCCGATCCTCTATCAACATCTATTCTGATTCTTC