Chromis xanthura | University of the Philippines Mindanao | Marine Biodiversity Database Project
Chromis xanthura
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Perciformes
  • Family » Pomacentridae
  • Genus » Chromis
  • Species » xanthura
  • Chromis xanthura
    (Paletail chromis)
  • Description »  

    Marine; reef-associated; non-migratory; depth range 0 - 40 m . Tropical; 35°N - 25°S

    Maturity: Lm ?  range ? - ? cm Max length : 17.0 cm TL male/unsexed;

    Dorsal spines (total): 13; Dorsal soft rays (total): 10 - 11; Anal spines: 2; Anal soft rays: 10 - 11. This species is distinguished by the following set of characters: D XIII,10-11(mode 11); A II,10-11 (11); pectoral-fin rays 18-20 (19); upper and lower procurrent caudal-fin rays 3; pored lateral-line scales 17-18 (18); gill rakers 6-8 (7) + 19-22 (21) = 26-30 (28); longest dorsal-fin soft ray length 24.6-36.4% (mean 29.4%) of SL; first anal-fin spine length 6.5-8.4% (7.1%) of SL; caudal-fin length 43.9-59.8% (48.6%) of SL; posterior tips of caudal-fin lobes are filamentous; broad black bands along the preopercular and opercular margins, sum width of two bands 15.3-27.9% (23.6%) of head length; distal half of soft-rayed portion of the dorsal fin is transparent in adults; upper or lower caudal-fin base no triangular black blotches; caudal peduncle and fin are tinged with yellow; soft-rayed portions of dorsal and anal fins are yellowish, with spinous portion of dorsal and pelvic fins dark blue in juveniles . Body shape (shape guide): short and / or deep;  Cross section: compressed.

    Full article at FishBase
  • Local Name »  
  • Locality/Distribution »   [Santa Cruz, Davao del Sur]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   [FDP_STAC_2211_007A]
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
    Least Concern (LC); Date assessed:03 February 2021 (FishBase)
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524346
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Nov. 28, 2024, 1:20 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    ATCGGCACCCTTTATCTAGTATTTGGTGCTTGAGCTGGAATAGTAGGCACAGCATTGAGCCTTCTCATTCGAGCAGAACTAAGTCAACCAGGCGCTCTCCTCGGAGACGACCAAATCTACAACGTTATCGTTACGGCACACGCCTTTGTGATGATTTTCTTTATAGTAATACCAATCATGATTGGAGGATTTGGAAACTGACTTATCCCCCTTATGATCGGGGCCCCTGACATGGCTTTCCCTCGAATAAACAACATGAGCTTCTGACTCTTACCTCCCTCATTCCTACTTCTGCTCGCCTCCTCTGGTGTCGAAGCAGGTGCTGGTACAGGGTGAACTGTATATCCCCCCCTTTCCGGGAATCTAGCACATGCAGGTGCCTCCGTAGACTTAACCATCTTCTCCCTTCACCTAGCAGGTATTTCCTCAATCCTTGGGGCTATTAACTTCATTACTACTATTATCAATATGAAACCCCCTGCCATCTCCCAATATCAAACCCCTCTATTTGTATGAGCAGTCCTTATCACCGCGGTGCTTCTCCTCTTATCCCTCCCAGTCCTAGCTGCTGGCATCACGATACTTCTAACTGATCGTAACCTGAACACCACCTTCTTCGACCCTGCGGGAGGAGGGGACCCAATCCTTTACCAACACCTA