Amphiprion perideraion | University of the Philippines Mindana | Marine Biodiversity Database Project
Amphiprion perideraion
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Perciformes
  • Family » Pomacentridae
  • Genus » Amphiprion
  • Species » perideraion
  • Amphiprion perideraion
    (Pink anemonefish)
  • Description »   (Wikipedia) The pink skunk clownfish (Amphiprion perideraion), also known as the pink anemonefish, is a species of anemonefish that is widespread from northern Australia through the Malay Archipelago and Melanesia. Like all anemonefishes, it forms a symbiotic mutualism with sea anemones and is unaffected by the stinging tentacles of the host. It is a sequential hermaphrodite with a strict size-based dominance hierarchy; the female is largest, the breeding male is second largest, and the male nonbreeders get progressively smaller as the hierarchy descends. They exhibit protandry, meaning the breeding male changes to female if the sole breeding female dies, with the largest nonbreeder becoming the breeding male.
    Full article at Wikipedia
  • Local Name »  
  • Locality/Distribution »   [Santa Cruz, Davao del Sur]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindana
  • Collection Code »   FDP_STAC_2211_008A
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524245
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Sept. 15, 2024, 9:19 p.m.
    • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    ATCGGCACCCTTTATCTAATTTTCGGTGCTTGAGCTGGAATAGTAGGCACGGCCTTAAGCCTTCTTATTCGAGCAGAATTAAGCCAACCAGGCGCACTTTTAGGAGATGATCAGATTTATAACGTTATTGTTACCGCACATGCCTTCGTAATAATTTTCTTTATAGTAATACCAATTCTAATTGGAGGGTTTGGAAACTGACTAGTACCCCTTATGCTTGGCGCCCCCGATATAGCATTTCCTCGCATAAACAACATAAGCTTCTGACTTCTCCCTCCCTCCTTCCTTCTTCTGCTTGCCTCCTCAGGGGTTGAAGCGGGGGCCGGAACAGGCTGAACTGTATACCCACCACTGTCTGGAAACCTAGCCCATGCAGGAGCATCAGTAGACCTAACTATCTTCTCCCTCCACCTGGCAGGTGTTTCATCAATCCTGGGAGCAATCAACTTTATTACTACCATTATTAACATGAAACCCCCTGCCATCACACAGTATCAAACCCCTCTATTTGTTTGAGCTGTCCTAATTACTGCTGTTCTTCTCCTCCTCTCTCTCCCAGTTTTAGCTGCCGGTATTACTATGCTCTTAACGGACCGAAACCTAAATACTACCTTCTTTGACCCAGCAGGAGGAGGAGATCCAATTCTTTACCAACACCTTTTCTGA

    • Visit BOLD Systems Website
    University of the Philippines Mindanao, Mintal, Tugbok District, Davao City © ABRAHAM Program 2024 - All Rights Reserved. 967 visit(s) today - 303064 total visits (551 average daily visits): 2023-05-22 - 2024-11-22 (550 days)