Coris batuensis | University of the Philippines Mindanao | Marine Biodiversity Database Project
Coris batuensis
  • Classification
  • Kingdom » Animalia
  • Phylum » Chordata
  • Class » Actinopterygii
  • Order » Labriformes
  • Family » Labridae
  • Genus » Coris
  • Species » batuensis
  • Coris batuensis
    (Batu coris)
  • Description »   (Wikipedia) Coris batuensis, the Batu coris, also known as the Batu rainbow-wrasse, the variegated wrasse, the dapple coris, pallid wrasse, Schroeder's coris, Schroeder's rainbow wrasse, variegated rainbowfish or yellow wrasse, is a species of wrasse native to the Indian Ocean and the western Pacific Ocean from the African coast to the Marshall Islands and from southern Japan to Australia's Great Barrier Reef and Tonga. This species is an inhabitant of coral reefs and surrounding areas at depths from 2 to 30 m (6.6 to 98.4 ft), though it is rarer deeper than 15 m (49 ft). It can reach 17 cm (6.7 in) in total length. It is of minor importance to local commercial fisheries and can also be found in the aquarium trade.
    Full article at Wikipedia
  • Local Name »  
  • Locality/Distribution »   [Santa Cruz, Davao del Sur]
  • Collectors/Field Observers »  
  • Species ID by »  
  • Institution/Project »   University of the Philippines Mindanao
  • Collection Code »   FDP_STAC_2211_012A
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • IUCN Conservation Status »   Visit IUCN
  • Sample Availability and Preservation »  
  • GenBank Accession Number »   OR524350
  • Curated by »   mafortaleza-dc (Maybelle Fortaleza)
  • Last Updated »   Sept. 15, 2024, 9:10 p.m.
  • Cite this page as: Fortaleza, M.A., Labrador, K.L., Lanutan, J.J., Bacus, M.G., Consuegra, J.M., del Fierro, J.E.L.F., Sobradil, R.B., Opina, R.L., Cabasan, J.P., Eballe, A.C. and Gumanao, G.S., 2024. The marine fishes from southern Mindanao, Philippines, including a DNA barcode reference library of commercially important species. Bulletin of Marine Science. https://doi.org/10.5343/bms.2023.0116
  • DNA Sequence »

    ATCGGCACCCTCTATTTAGTATTCGGGGCCTGGGCCGGAATGGTGGGCACAGCCTTAAGCTTACTTATCCGCGCGGAACTAAGCCAACCCGGCGCCCTCCTTGGAGACGACCAAATTTACAATGTAATTGTTACAGCCCATGCTTTCGTAATAATCTTCTTTATAGTAATACCTATTATGATTGGGGGCTTTGGAAACTGACTTATTCCTTTAATGATTGGGGCGCCTGACATGGCCTTCCCTCGAATGAACAACATGAGCTTCTGACTCCTGCCCCCATCATTCCTCCTTCTCCTCGCCTCCTCAGGTGTAGAAGCAGGTGCAGGGACCGGCTGAACAGTCTACCCGCCCCTGGCAGGGAACCTGGCCCATGCCGGAGCCTCTGTTGATCTGACTATCTTCTCACTTCACTTAGCTGGCATTTCGTCAATTCTAGGAGCAATTAATTTTATTACTACTATTATTAATATGAAACCCCCTGCCATCTCCCAGTACCAAACCCCTCTTTTCGTCTGAGCCGTTCTAATTACAGCAGTCCTCCTCCTTCTCTCCCTCCCTGTATTAGCTGCCGGCATCACTATGCTTCTCACAGACCGAAATCTAAACACCACCTTCTTCGACCCTGCAGGAGGCGGTGACCCCATCCTCTACCAACATTTATGCTGA